Candida glabrata (Anderson) Meyer et Yarrow (ATCC® 90030)

Strain Designations: NCCLS 84  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Torulopsis glabrata (Anderson) Lodder et de Vries
Strain Designations NCCLS 84
Application
Susceptibility testing antifungal agents
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

TTAAAGACGTCTGTCTGCCCAGCACGCACAAAACACTCACATATCCCTCCCTAGATCAACACCGAGTTGGTAAAACCTAATACAGTATTAACCCCCGCCGCTCGCGCAAACGAGCAGCAGATTAATAGAGAAGCTTGCGCTCGTGTCCCACATACTGATATGGCCTACAATTTCAAGTTAACTCAAAAACGAGAGTATCACTCACTACCAAACACAACGTGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCATTGTTGAAAGTTTTGAAGTTGTTTTCTACTAAAAGAAATCTTGTGTTGACTGAATTAGTTTAAAAAAATATTTGTTTGTGTTTGCATCCACTGGGAGAACTCCCCCCCGAAAGAGAGCGTTCCCCCAACGAACAAAAGAATAGTAGTAAAGTAAACTCCACTGTGTGTAGTAATTAGAAAGTGTCGAGTCGTGTGATAAAACACCTCCTTTGGAATAGAGAGATCCACGCACACTCCCAGGTCTTTGTCGGCTCCCTCCCCCCACTGCAGAACACCCACCAACCGCGCACTTAAGCGCAGGCAGGAGAAATGGCATTCACAGCAGAGAAAATATTTTAGGAGCCTCCTGAGTGTCTACACTGGTCCTCCCCAGAGATGTCTCT


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTGGTGCCCGAGTTGTAATTTGGAGAGTACCACTTTGGGACTGTACTTTGCCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGGCGAGGGTGTCAGTTCTTTGTAAAGGGTGCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTTGCCTCTCGTGGGCTTGGGACTCTCGCAGCTCACTGGGCCAGCATCGGTTTTGGCGGCCGGAAAAAACCTAGGGAATGTGGCTCTGCGCCTCGGTGTAGAGTGTTATAGCCCTGGGGAATACGGCCAGCCGGGACCGAGGACTGCGATACTTGTTATCTAGGATGCTGGCATAATGGTTATATGCCG

Name of Depositor MA Pfaller
Isolation
Blood, Iowa
Cross References

Nucleotide (GenBank) : AJ289782 Candida glabrata partial ORF1 for putative mitochondrial protein.

References

Espinel-Ingroff A, et al. Collaborative comparison of broth macrodilution and microdilution antifungal susceptibility tests. J. Clin. Microbiol. 30: 3138-3145, 1992. PubMed: 1452697

Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation