Alternaria alternata (Fries) Keissler (ATCC® 6663)

Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Alternaria tenuis Nees
Application
produces ALT-I
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments
Allergenic fraction (ALT-I)
Medium ATCC® Medium 343: V8 juice agar
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 340: Rabbit food agar
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGG

Name of Depositor JE Machacek
Chain of Custody
ATCC <-- JE Machacek <-- CBS
References

Yunginger JW, et al. Studies on Alternaria allergens. III. Isolation of a major allergenic fraction (ALT-1). J Allergy Clin Immunol 66: 138-147, 1980. PubMed: 7190582

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation