Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® 4098)

Alternate State: Candida robusta Diddens et Lodder  /  Strain Designations: [657, IFO 1661]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces ellipsoideus Reess, teleomorph
Classification Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae
Strain Designations [657, IFO 1661]
Alternate State Candida robusta Diddens et Lodder
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Morphology After 4 days on YM at 25°C, colonies are white, smooth, butyrous. Cells are ovoidal, single, in pairs and small clusters; pseudohyphae absent.
Medium Medium 200: YM agar or YM broth
Medium 28: Emmons' modification of Sabouraud's agar
Medium 1245: YEPD
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCGTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC

Morphology After 4 days on YM at 25°C, colonies are white, smooth, butyrous. Cells are ovoidal, single, in pairs and small clusters; pseudohyphae absent.
Name of Depositor FA McDermott
Chain of Custody
ATCC <-- FA McDermott <-- Am. Museum Coll. 657 <-- Wortmann
Isolation
German white wine yeast
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation