Rhizopus stolonifer (Ehrenberg : Fries) Lind (ATCC® 14037)

Strain Designations: UNB-1 [IMI 90609, VKM F-402]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations UNB-1 [IMI 90609, VKM F-402]
Application
Produces polygalacturonase endopolygalacturonase, pectinase
Produces kynureninase-type enzymes
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Mating Type plus tester mating type
Comments
Zygospore germination
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTTCCCTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCCTAGCTAAACAGGATTGTAAACTGTAGAAGTGTTTTCCAGGCAATCCGAGTTAATAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGATTCGAGATATTTTGTCTTTTGCGATACACTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAATTGGGTGGTAAATCTCACCTAAAGCTAAATATTGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAACCGTTTGGAGCCAGACTGGCTTGTCTGTAATCAATCTAGGTTTCGTGCCTGGATGCACTTGCAGACTATTTGCCTGCCAACGACAATTTTTTTTGAGTGTAAAAACTATTGGAAATGTGGCCAATATTTATTTATTGGTGTTATAGTCCTTTAGAAAATACCTTGAATTGGATTGAGGAACGCAGCGAATGCTTCTCTTTTGAGGCAAAGTCTTTTATTGGGATTTACGGATCAGACTGTGGCATTGTCACAAGACTTGAAGTTTAAACCTATTTTTGAACTTTTATTCGCTTAGGTTGTTGGCTTAATGACTCTAAATGA

Name of Depositor WL Gauger
Chain of Custody ATCC <-- WL Gauger
Cross References

Nucleotide (GenBank) : L47267 Rhizopus stolonifer beta-tubulin gene, partial cds.

Nucleotide (GenBank) : AF117935 Rhizopus stolonifer ATCC 14037 5.8S ribosomal RNA gene, partial

References

Am. J. Bot. 48: 427-429, 1961.

Shetty AS, Gaertner FH. Kynureninase-type enzymes of Penicillium roqueforti, Aspergillus niger, Rhizopus stolonifer, and Pseudomonas fluorescens: Further evidence for distinct kynureninase and hydroxykynureninase activities. J. Bacteriol. 122: 235-244, 1975. PubMed: 164432

Trescott AS, Tampion J. Properties of the endopolygalacturonase secreted by Rhizopus stolonifer. J. Gen. Microbiol. 80: 401-409, 1974.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation