Candida albicans (Robin) Berkhout (ATCC® 11006)

Strain Designations: [ATCC 42266, CBS 1905, CCRC 20518, CECT 1439, DBVPG 6157, IFO 1397, JCM 1543]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Candida stellatoidea (Jones et Martin) Langeron et Guerra, anamorph
Strain Designations [ATCC 42266, CBS 1905, CCRC 20518, CECT 1439, DBVPG 6157, IFO 1397, JCM 1543]
Application
Control strain for identification
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain of Candida stellatoidea)
Preceptrol® yes
Comments
Esterase activity
Morphology and physiology of strain sectors
Lipid composition
Cell wall mannans
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCTACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Name of Depositor NF Conant
Chain of Custody ATCC <-- NF Conant
References

Leaw SN, et al. Identification of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J. Clin. Microbiol. 44: 693-699, 2006. PubMed: 16517841

Diezmann S, et al. Phylogeny and evolution of medical species of Candida and related taxa: a multigenic analysis. J. Clin. Microbiol. 42: 5624-5635, 2004. PubMed: 15583292

Chen YC, et al. Polymorphic internal transcribed spacer region 1 DNA sequences identify medically important yeasts. J. Clin. Microbiol. 39: 4042-4051, 2001. PubMed: 11682528

Tintelnot K, et al. Evaluation of phenotypic markers for selection and identification of Candida dubliniensis. J. Clin. Microbiol. 38: 1599-1608, 2000. PubMed: 10747150

Kobayashi H, et al. Structures of cell wall mannans of pathogenic Candida tropicalis IFO 0199 and IFO 1647 yeast strains. Infect. Immun. 62: 615-622, 1994. PubMed: 7507898

Donnelly SM, et al. Phylogenetic analysis and rapid identification of Candida dubliniensis based on analysis of ACT1 intron and exon sequences. Microbiology 145: 1871-1882, 1999. PubMed: 10463153

Rudek W. Esterase activity in Candida species. J. Clin. Microbiol. 8: 756-759, 1978. PubMed: 370150

Saltarelli CG. Morphological and physiological variations between sectors isolated from giant colonies of Candida albicans and C. stellatoidea. Mycopathol. Mycol. Appl. 34: 209-220, 1968.

Jones CP, Martin DS. Identification of yeast-like organisms isolated from the vaginal tracts of pregnant and nonpregnant women. Am. J. Obstet. Gynecol. 35: 98-106, 1938.

type strain of Candida stellatoidea

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation