Cryptococcus albidus (Saito) Skinner var. albidus (ATCC® 10666)

Strain Designations: NRRL Y-1400 [CBS 142, CCRC 21672, CCY 17-14-1, IFO 0378, IFO 0610, IFO 0764, JCM 2324, MUCL 30400, NCYC 445, VKM Y-2223]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Cryptococcus albidus (Saito) Skinner var. albidus, anamorph
Strain Designations NRRL Y-1400 [CBS 142, CCRC 21672, CCY 17-14-1, IFO 0378, IFO 0610, IFO 0764, JCM 2324, MUCL 30400, NCYC 445, VKM Y-2223]
Application
Produces propane
Produces xylosidases xylan-hydrolases
Deacylation of benzyl- and phenoxymethyl penicillin tetrazoles
Quality control strain for Abbott products
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® yes
Morphology After 5-6 days on YM medium, cells are globose to ovoidal, (3.0-6.1) x (3.5-6.2) µm, and single, in pairs and often in small clusters or short chains. Elongate cells may be present. Usually a small amount of sediment is formed.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGATTGACCGTCTGTCGAGCTTGCTCACAGGCACATCATATCCATAACACCTGTGCACTTGTCGGATGGCTTAGTGAAGACCGCAAGGTTGAATCTATCCATCTACTTTACATAACAATTCTGTAACAAATGTAGTCTTATTATAACATAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAAACCCTCAACCCTAGATTGGTTAAAACCTCTCTTTGGTTTGGATTTGGACGTTTGCCGATGATAAGTCGGCTCGTCTTAAAAGTAATAGCTGGATCTGTCTCGCGACATGGTTTGACTTGGCGTAATAAGTATTTCGCTAAGGACATCTTCGGATGGCCGCGTTGCAGGACTAAAGACCGCTTTCTAATCCATTGATCTTCGGATTAATACTCTTGACATCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGGTAGCCTTCGGTTGCCCGAGTTGTAATCTAGAGAAGTGTTTTCCGTGCCGGCCCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGGACCCCCGGTGCTTTGTGATACACTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCTCTTGGGACTTACCTCCCTTGAGTGGGGTCAACATCAGTTTTGATCGATGGATAAAGGCACGGGGAAGGTAGCACTCTCGGGTGAACTTATAGCCTCGCGTCATATACATTGATTGGGACTGAGGAACGCAGCATGCCTTATGGCCGGGATTCGTCCACGTACATGCTTAGGATGTTGACATAATGGCTTTAAACGAC

Morphology After 5-6 days on YM medium, cells are globose to ovoidal, (3.0-6.1) x (3.5-6.2) µm, and single, in pairs and often in small clusters or short chains. Elongate cells may be present. Usually a small amount of sediment is formed.
Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- CBS 142 <-- CLMR (Torula albida)
Isolation
Air, Japan
Cross References

Nucleotide (GenBank) : JQ070095 ITS including 5.8S rRNA gene

References

Hamsher JJ. Enzymatic deacylation of benzyl- and phenoxymethyl penicillin tetrazoles. US Patent 3,905,868 dated Sep 16 1975

. . Phytochemistry 34: 133-138, 1993.

Saito K. Untersuchungen uber die atmospharischen Pilzkeime. Jpn. J. Bot. 1: 1-54, 1922.

Biely P, et al. Xylan-degrading activity in yeasts: growth on xylose, xylan and hemicelluloses. Folia Microbiol. 23: 366-371, 1978.

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

Fukuda H, et al. Microbial production of C3- and C4-hydrocarbons. Agric. Biol. Chem. 48: 1679-1682, 1984.

McTaggart LR, et al. Rapid identification of Cryptococcus neoformans and Cryptococcus gattii by matrix-assisted laser desorption ionization-time of flight mass spectrometry. J. Clin. Microbiol. 49: 3050-3053, 2011. PubMed: 21653762

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation