Cryptococcus albidus (Saito) Skinner var. albidus (ATCC® 10666)

Strain Designations: NRRL Y-1400 [CBS 142, CCRC 21672, CCY 17-14-1, IFO 0378, IFO 0610, IFO 0764, JCM 2324, MUCL 30400, NCYC 445, VKM Y-2223]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Cryptococcus albidus (Saito) Skinner var. albidus, anamorph
Strain Designations NRRL Y-1400 [CBS 142, CCRC 21672, CCY 17-14-1, IFO 0378, IFO 0610, IFO 0764, JCM 2324, MUCL 30400, NCYC 445, VKM Y-2223]
Application
Produces propane
Produces xylosidases xylan-hydrolases
Deacylation of benzyl- and phenoxymethyl penicillin tetrazoles
Quality control strain for Abbott products
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® yes
Morphology After 5-6 days on YM medium, cells are globose to ovoidal, (3.0-6.1) x (3.5-6.2) µm, and single, in pairs and often in small clusters or short chains. Elongate cells may be present. Usually a small amount of sediment is formed.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGATTGACCGTCTGTCGAGCTTGCTCACAGGCACATCATATCCATAACACCTGTGCACTTGTCGGATGGCTTAGTGAAGACCGCAAGGTTGAATCTATCCATCTACTTTACATAACAATTCTGTAACAAATGTAGTCTTATTATAACATAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAAACCCTCAACCCTAGATTGGTTAAAACCTCTCTTTGGTTTGGATTTGGACGTTTGCCGATGATAAGTCGGCTCGTCTTAAAAGTAATAGCTGGATCTGTCTCGCGACATGGTTTGACTTGGCGTAATAAGTATTTCGCTAAGGACATCTTCGGATGGCCGCGTTGCAGGACTAAAGACCGCTTTCTAATCCATTGATCTTCGGATTAATACTCTTGACATCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGGTAGCCTTCGGTTGCCCGAGTTGTAATCTAGAGAAGTGTTTTCCGTGCCGGCCCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGGACCCCCGGTGCTTTGTGATACACTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCTCTTGGGACTTACCTCCCTTGAGTGGGGTCAACATCAGTTTTGATCGATGGATAAAGGCACGGGGAAGGTAGCACTCTCGGGTGAACTTATAGCCTCGCGTCATATACATTGATTGGGACTGAGGAACGCAGCATGCCTTATGGCCGGGATTCGTCCACGTACATGCTTAGGATGTTGACATAATGGCTTTAAACGAC

Morphology After 5-6 days on YM medium, cells are globose to ovoidal, (3.0-6.1) x (3.5-6.2) µm, and single, in pairs and often in small clusters or short chains. Elongate cells may be present. Usually a small amount of sediment is formed.
Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- CBS 142 <-- CLMR (Torula albida)
Isolation
Air, Japan
Cross References

Nucleotide (GenBank) : JQ070095 ITS including 5.8S rRNA gene

References

Hamsher JJ. Enzymatic deacylation of benzyl- and phenoxymethyl penicillin tetrazoles. US Patent 3,905,868 dated Sep 16 1975

. . Phytochemistry 34: 133-138, 1993.

Saito K. Untersuchungen uber die atmospharischen Pilzkeime. Jpn. J. Bot. 1: 1-54, 1922.

Biely P, et al. Xylan-degrading activity in yeasts: growth on xylose, xylan and hemicelluloses. Folia Microbiol. 23: 366-371, 1978.

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

Fukuda H, et al. Microbial production of C3- and C4-hydrocarbons. Agric. Biol. Chem. 48: 1679-1682, 1984.

McTaggart LR, et al. Rapid identification of Cryptococcus neoformans and Cryptococcus gattii by matrix-assisted laser desorption ionization-time of flight mass spectrometry. J. Clin. Microbiol. 49: 3050-3053, 2011. PubMed: 21653762

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation