Lachancea dasiensis Lee (ATCC® MYA-4748)

Strain Designations: SC5L02 [CBS 10888, BCRC 23139]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations SC5L02 [CBS 10888, BCRC 23139]
Application
ferments galactose and maltose.
Biosafety Level 1
Product Format frozen
Type Strain yes
Preceptrol® no
Morphology On MD-1245 at 25C for 3 days, colonies white to creamy white, butyrous, smooth, glistening, margin entire. On MD-200 at 25C for 12 days, cells globose to ovoidal, 5.25-7.5µm x 4.5-5.25µm.
Medium Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CTGCGGAAGGATCATTAAAGAAATTTGTTAGAGCAGCCGGGAAAGCTTGGATGCCTGCGCTTGATTGCGCGGCTGACGATGCTTTCTGTTAACGACTGTCTCTTCTACACACACACTGTGGAGTAATTTATTTACAACGCTTCTTCTTTGGGCTTCGGCCCAAGGGTTACAAACACAAACAACTTTTGTATTTTAAACATTGTCAATTATTTTTCATTTTAGAAAAAAATATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTATTGTGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACCTTAGGGTTTGGTAGTGAGTGGTACTCTTTCTGGGTTAACTTGAAAATGCTGGCCATCTGGCTGTTGCTGACTGAGACTTTAGTCCAGTCTGCTGATACTCTGCGTATTAGGTTTTACCAACTCGTAGTGGCGTTAGTAGGCGTTACAAAGACTTTTGTCAAAAGTACGGACAGCCTGGCAAACAGTATTCACAAAGTTTGACCTCAAATCAG

      26S large subunit ribosomal RNA gene, partial sequence.

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGCAACTTTGGGGCTAGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTTTGGCGAGGAGTCTAGTCCTATGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGACCCTCGCTCCTTGTGGGTGGGGATCTCGCAGTTCACTGGGCCAACATCAGTTTTGGCGGCAGGATAAATCTTTGGGAATGTGGCTTTTCTTCGGAGAAGCGTTATAGACCAGGGGAATACTGCCAGCCGGGACTGAGGACTGCGACTTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGCCCGTCTT

Morphology On MD-1245 at 25C for 3 days, colonies white to creamy white, butyrous, smooth, glistening, margin entire. On MD-200 at 25C for 12 days, cells globose to ovoidal, 5.25-7.5µm x 4.5-5.25µm.
Name of Depositor CF Lee
Special Collection ATCC
Chain of Custody
ATCC <-- CF Lee
Isolation
Leaf of Angiopteris lygodiifolia in Dasi, Taoyuan, Taiwan.
Cross References

Nucleotide (GenBank) : HQ999954 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : HQ999976 ITS including 5.8S rRNA gene

References

Lee CF, et al. Lachancea dasiensis sp. nov., an ascosporogenous yeast isolated from soil and leaves in Taiwan. Int. J. Syst. Evol. Microbiol. 59: 1818-1822, 2009.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation