Laccaria bicolor (Maire) Orton, teleomorph (ATCC® MYA-4686)

Strain Designations: S238N-H82  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations S238N-H82
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Mycorrizal fungus.
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Medium Medium 1269: MMN (Marx 1969)
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
>ITS sequence of MYA-4686

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACCTGATGTGATTGTTAGCTGGCTTTTCGAAGCATGTGCTCATCCGTCATCTTTATCTCTCCACCTGTGCACATTTTGTAGTCTTGGATACCTCTCGAGGAAACTCGGATTTTAGAATCGCTGTGCTGTACAAGTCGGCTTTTCTTTCATTTCCAAGACTATGTTTTTATATACACCAAAGTATGTTTATAGAATGTCATCAATGGGAACTTGTTTCCTATAAAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTCCAACTTTTATTAGCTTGGTTAGGCTTGGATGTGGGGGTTGCGGGCTTCATTAATGAGGTCGGCTCTCCTTAAATGCATTAGCGGAACTTTTGTGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTGAAGCAGCTTTATGAAGTTCTGCTTCTAACCGTCCATTGACTTGGACAATTTTGATAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

Name of Depositor F Martin
Special Collection ATCC
Chain of Custody
ATCC <-- F. Martin
Isolation
under Tsuga mertensiana, Crater Lake National Park, Oregon, USA.
Cross References

Complete Genome (GenBank) : ABFE00000000 Laccaria bicolor S238N-H82, whole genome shotgun sequencing project

References

Martin F, et al. The genome of Laccaria bicolor provides insights into mycorrhizal symbiosis. Nature 452: 88-92, 2008.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation