Laccaria bicolor (Maire) Orton, teleomorph (ATCC® MYA-4686)

Strain Designations: S238N-H82  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations S238N-H82
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Mycorrizal fungus.
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Sequenced Data
ITS sequence of MYA-4686

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACCTGATGTGATTGTTAGCTGGCTTTTCGAAGCATGTGCTCATCCGTCATCTTTATCTCTCCACCTGTGCACATTTTGTAGTCTTGGATACCTCTCGAGGAAACTCGGATTTTAGAATCGCTGTGCTGTACAAGTCGGCTTTTCTTTCATTTCCAAGACTATGTTTTTATATACACCAAAGTATGTTTATAGAATGTCATCAATGGGAACTTGTTTCCTATAAAATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTCCAACTTTTATTAGCTTGGTTAGGCTTGGATGTGGGGGTTGCGGGCTTCATTAATGAGGTCGGCTCTCCTTAAATGCATTAGCGGAACTTTTGTGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTGAAGCAGCTTTATGAAGTTCTGCTTCTAACCGTCCATTGACTTGGACAATTTTGATAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

Name of Depositor F Martin
Special Collection ATCC
Chain of Custody
ATCC <-- F. Martin
Isolation
Under Tsuga mertensiana, Crater Lake National Park, Oregon, USA.
Cross References

Complete Genome (GenBank) : ABFE00000000 Laccaria bicolor S238N-H82, whole genome shotgun sequencing project

References

Martin F, et al. The genome of Laccaria bicolor provides insights into mycorrhizal symbiosis. Nature 452: 88-92, 2008.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation