Wallemia sebi (Fries) von Arx (ATCC® MYA-4683™) Strain Designations: CBS 633.66 / Product Format: frozen General Information Characteristics Culture Method Specifications History Documentation Print Email Share Share this product Facebook Twitter Google+ Permits These permits may be required for shipping this product: Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment. Strain Designations CBS 633.66 Biosafety Level 1 Product Format frozen Type Strain no Genome Sequenced Strain Yes Comments Osmophilic fungus.Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA). Medium ATCC® Medium 340: Rabbit food agar Growth Conditions Temperature: 20.0-25.0°C Sequenced Data >D1D2 sequence for MYA-4683AGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAAGCTGTTGTCTTTCAGGCAACCGCATTGTAATCTCAAGAAGTGTTTTCGATTGTAGCCTGCGTATAAGTACCTTGGAATAGGTTGGCATAGAGGGTGAAACTCCCGTCTTTGATGCAGATTACTATGATCATGTGATACACTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGAACGTGAAATTGCTGAAAGGGAAGCGTTTGAAGTTAGTCTGATAGGAGTTGTTCAATTGTTACTTTGGTTTCAATGTATGCAACTTTTTATCGGTCAACATCAATTTTGATTGATGGATAAAGGTAATAGGAATGTGGCTACAATTTGTAGTGTTATAGCCTATTATCATAAACATTGATTGAGATTGAGGACGGCAGTGTACCTTTTAGGAAGGTGTTCGCACCTATTACACTAAGGA Name of Depositor CBS Special Collection ATCC Chain of Custody ATCC <-- CBS <-- RB Kenneth Isolation date honey Cross References Complete Genome (GenBank) : AFQX00000000 Wallemia sebi CBS 633.66, whole genome shotgun sequencing project Permits These permits may be required for shipping this product: Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment. Basic Documentation Product Sheet Certificate of Analysis MSDS