Wallemia sebi (Fries) von Arx (ATCC® MYA-4683)

Strain Designations: CBS 633.66  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations CBS 633.66
Biosafety Level 1
Product Format frozen
Type Strain no
Genome Sequenced Strain

Yes

Comments
Osmophilic fungus.
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Medium ATCC® Medium 340: Rabbit food agar
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
      >D1D2 sequence for MYA-4683

AGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAAGCTGTTGTCTTTCAGGCAACCGCATTGTAATCTCAAGAAGTGTTTTCGATTGTAGCCTGCGTATAAGTACCTTGGAATAGGTTGGCATAGAGGGTGAAACTCCCGTCTTTGATGCAGATTACTATGATCATGTGATACACTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGAACGTGAAATTGCTGAAAGGGAAGCGTTTGAAGTTAGTCTGATAGGAGTTGTTCAATTGTTACTTTGGTTTCAATGTATGCAACTTTTTATCGGTCAACATCAATTTTGATTGATGGATAAAGGTAATAGGAATGTGGCTACAATTTGTAGTGTTATAGCCTATTATCATAAACATTGATTGAGATTGAGGACGGCAGTGTACCTTTTAGGAAGGTGTTCGCACCTATTACACTAAGGA

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- RB Kenneth
Isolation
date honey
Cross References

Complete Genome (GenBank) : AFQX00000000 Wallemia sebi CBS 633.66, whole genome shotgun sequencing project

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation