Heterogastridium pycnidioideum Oberw. et R. Bauer (ATCC® MYA-4631)

Strain Designations: RJB 75-845L  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations RJB 75-845L
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Reference strain for AFTOL (Assembling the Fungal Tree of Life) project
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Sequenced Data
ITS DNA sequence of MYA-4631

TAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGGAGGCCGGCCCCCCAGGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC


18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGATCATTAGTGAATTTGTTGGATTTCTAATCCACACTCTCTCACTTTCTAACCCTGTGAACTTATTATAAAATGGCATTTGAATGTTAACGCGTTCGTTTGTTGTTTTTTATATTATAAACTTAGTAAAGTTGAAGAATGTATTTTTTTATAACAAATAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACCTTGCACTCTTTGGTATTCCGAAGAGTATGCCTGTTTGAGTGTTATGAAATCTCTCAACCTATCATTTTTCATTAGAACTTTGATTAGGATTGGATTCTGAACGTTGCTGACTAGTTTACTAGTGGAGCTCGTTTGAAATAGAATAGCAAATGTCTGATCTTTAATCGGTTTGACTTGGCGTAATAAGTAACATTTCGCTAAGGATTATCCTCTGGGTAACCGAATTTTGTATTAATGACTTGCTTCTAAATCTTAATTTTCTAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAT


D1D2 region of the 28S ribosomal RNA gene

TCAGTAACGGCGAGTGAAGTGGGAAGAGCTCAAATTTGTAATCTGGCACTTTCAGTGTCCGAGTTGTAATCTCGAGAAGTGTTTTCCGTGCTAGACCGTATTTAAGTCTGTTGGTATACAGCGTCATAGTGGTGAGAACCCAGTATATGTTACGGATGCCTAGTACTTTGTGATACACTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCTGACTTGCTTTTGGGATTCGTCCTATTGGCAGGCTAGCATCAGTTTTTGGGGATAGAAAAGGGTATTGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTTTACTGGATCTATCCTCGGGGACTGAGGATCGCAACACGCTTTGTGCAATACTCTCGAGTATTTCGTGTTAAGGATGCTAGTTAAGGGCTTTAAACGACCCGTCTTG

Name of Depositor MC Aime
Special Collection ATCC
Chain of Custody
ATCC <-- MC Aime
Cross References

Nucleotide (GenBank) : GU291290 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : GU291276 ITS including 5.8S rRNA gene

References

Hibbett DS, et al. A higher level phylogenetic classification of the Fungi. Mycol. Res. 111: 509-547, 2007.

Aime MC, et al. An overview of the higher level classification of Pucciniomycotina based on combined analyses of nuclear large and small subunit rDNA sequences. Mycologia 98: 896-905, 2006.

Swann EC, Taylor JW. Phylogenetic diversity of yeast-producing basidiomycetes. Mycol. Res. 99: 1205-1210, 1995.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation