Nectria haematococca Berkeley et Broome, teleomorph (ATCC® MYA-4622)

Strain Designations: FGSC 9596 [mpVI 77-13-4]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations FGSC 9596 [mpVI 77-13-4]
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Plant pathogen.
Medium Medium 336: Potato dextrose agar (PDA)
Medium 324: Malt extract agar
Growth Conditions
Temperature: 25.0°C
Sequenced Data
>ITS of MYA-4622

GTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTTCGGCGGGAACAGACGGCCCCGTGAAACGGGCCGCCCCCGCCAGAGGACCCCTAACTCTGTTTCTATAATGTTTCTTCTGAGTAAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAGGCCCCCGGGCCTGGCGTTGGGGATCGGCGGAGCCCCCCGTGGGCACACGCCGTCCCCCAAATGCAGTGGCGGTCCCGCCGCAGCTTCCATCGCGTAGTAGCTAACACCTCGCGACTGGAGAGCGGCGCGGCCACGCCGTAAAACACCCAACTCTTCTGAAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA

//

Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Cross References

Nucleotide (GenBank) : GU327638 ITS including 5.8S rRNA gene

References

Coleman JJ, et al. The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion. PLoS Genet 5: e1000618, 2009.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation