Nectria haematococca Berkeley et Broome, teleomorph (ATCC® MYA-4622)

Strain Designations: FGSC 9596 [mpVI 77-13-4]  /  Product Format: frozen

Strain Designations FGSC 9596 [mpVI 77-13-4]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Plant pathogen.
Sequenced Data
>ITS of MYA-4622

GTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATTCAACTCATCAACCCTGTGAACATACCTAAACGTTGCTTCGGCGGGAACAGACGGCCCCGTGAAACGGGCCGCCCCCGCCAGAGGACCCCTAACTCTGTTTCTATAATGTTTCTTCTGAGTAAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAGGCCCCCGGGCCTGGCGTTGGGGATCGGCGGAGCCCCCCGTGGGCACACGCCGTCCCCCAAATGCAGTGGCGGTCCCGCCGCAGCTTCCATCGCGTAGTAGCTAACACCTCGCGACTGGAGAGCGGCGCGGCCACGCCGTAAAACACCCAACTCTTCTGAAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA

//

Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Cross References

Nucleotide (GenBank) : GU327638 ITS including 5.8S rRNA gene

References

Coleman JJ, et al. The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion. PLoS Genet 5: e1000618, 2009.