Hanseniaspora vineae Van der Walt et Tscheuschner (ATCC® MYA-4483)

Strain Designations: IY 03-5-26-5-C1 [NRRL Y-27936]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations IY 03-5-26-5-C1 [NRRL Y-27936]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments
Insect associated yeast.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
>LSU rDNA of MYA-4483

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGTAGAAGTAGTTTTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTCTTTGTAAAACGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTGGACGCCCTGCGCTCCTTGTGGGTGCAGGACACGCTTTTCACTGGGCCAACATCGGTTTTGGCAGCAGGATAAATCGTTAGGAACGTAGCTGCCCTCGGGTAGTGTTACAGCCTGGCGGAATACTGCTAGCCGGGACTGAGGACTGCGTCTTTTGACAAGGATGTTGGCATAATGGTTAAATGCCGC

//

Name of Depositor M Blackwell
Special Collection ATCC
Chain of Custody
ATCC <-- NH Nguyen, M Blackwell, SO Suh
Isolation
Body surface of Chauliodes rastricornis (Corydalidae, female), Walker, Livingston Par., Louisiana, USA.
Cross References

Nucleotide (GenBank) : FJ196743 D1/D2 region of 28S rRNA gene

References

Nguyen NH, Suh SO, Blackwell M. Five novel Candida species in insect-associated yeast clades isolated from Neuroptera and other insects. Mycologia 99: 842-858, 2007.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation