Hanseniaspora vineae Van der Walt et Tscheuschner (ATCC® MYA-4483)

Strain Designations: IY 03-5-26-5-C1 [NRRL Y-27936]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations IY 03-5-26-5-C1 [NRRL Y-27936]
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
Insect associated yeast.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
>LSU rDNA of MYA-4483

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGTAGAAGTAGTTTTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTCTTTGTAAAACGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTGGACGCCCTGCGCTCCTTGTGGGTGCAGGACACGCTTTTCACTGGGCCAACATCGGTTTTGGCAGCAGGATAAATCGTTAGGAACGTAGCTGCCCTCGGGTAGTGTTACAGCCTGGCGGAATACTGCTAGCCGGGACTGAGGACTGCGTCTTTTGACAAGGATGTTGGCATAATGGTTAAATGCCGC

//

Name of Depositor M Blackwell
Special Collection ATCC
Chain of Custody
ATCC <-- NH Nguyen, M Blackwell, SO Suh
Isolation
Body surface of Chauliodes rastricornis (Corydalidae, female), Walker, Livingston Par., Louisiana, USA.
Cross References

Nucleotide (GenBank) : FJ196743 D1/D2 region of 28S rRNA gene

References

Nguyen NH, Suh SO, Blackwell M. Five novel Candida species in insect-associated yeast clades isolated from Neuroptera and other insects. Mycologia 99: 842-858, 2007.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation