Ogataea nakhonphanomensis Limtong et al. (ATCC® MYA-4463)

Strain Designations: SO51 [BCC 21228, NBRC 101966, CBS 10362]  /  Product Format: frozen

Strain Designations SO51 [BCC 21228, NBRC 101966, CBS 10362]
Biosafety Level 1
Product Format frozen
Type Strain yes
Preceptrol® no
Comments
Thermotolerant methylotrophic yeast.
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
The ITS DNA sequence of MYA-4463 lot 58228765

GGAAGGATCATTACAGTATTCTTCTAAGCTGGATTCGTACGTCTCTCAACTATTTTGCCTGCGCTGCTGAAATATTGCGTGCGCGGTGATGGTTGACTGATTGCGGATCTGTTCAAGGCTTAGAAATCTCTACACACTTTGTTTTCTATTAGAGACAAATTTGCTTTGGTCAGTGATTGTTTAATTGCAATTAATCTGGCCAGAGGTTAACTAAACTCAATTTCGTTTTCCCCCGGGAAGATTGAAAACTTGTATTATATTTTGTCAGTTATAAAAAGTTGCTACGCAGCTTTTCTAAACTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGATTTTCGTGAATCATTGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACCCTTGGGTTTGGTGATGGGCAATACTCTTTTTGAGAGTTTGCTTGAAATGAATTGGCATGAGTTTTTGTTTGAACTTCAGCTGTTTATTCAATGTATTAGGTTTTATCCATCGTTGATTGACAATTGTAGCTTCTTTCAAAATTTGGCTCTGCCTTACAAACTTTATCATAAAGTTTGACCTCAAATCAGTA

Name of Depositor S Limtong
Special Collection ATCC Mycology
Chain of Custody
ATCC <-- S Limtong
Isolation
Tree exudate, Nakhon-Phanom Prov., Thailand.
Cross References

Nucleotide (GenBank) : FJ914925 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : FJ914911 18S rRNA gene

Nucleotide (GenBank) : JN863709 RPB 2 gene

Nucleotide (GenBank) : FJ914942 D1/D2 region of 28S rRNA gene

References

Limtong S, et al. Ogataea chonburiensis sp nov and Ogataea nakhonphanomensis sp nov., thermotolerant, methylotrophic yeast species isolated in Thailand, and transfer of Pichia siamensls and Pichia thermomethanolica to the genus Ogataea. Int. J. Syst. Evol. Microbiol. 58: 302-307, 2008.