Ogataea chonburiensis Limtong et al. (ATCC® MYA-4462)

Strain Designations: PT44 [BCC 21227, NBRC 101965, CBS 10363]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations PT44 [BCC 21227, NBRC 101965, CBS 10363]
Biosafety Level 1
Product Format frozen
Type Strain yes
Preceptrol® no
Comments
Thermotolerant methylotrophic yeast
Medium Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 25.0°C
Sequenced Data
The ITS DNA sequence of MYA-4462 lot 58228764

GGAAGGATCATTACAGTATTCTTCTAAGCTGGAGCTGTTTACTAGTGATTGATTTGCCTGCGCTGCTGAAATATTGCGTGCGCGGCAAGAGATCATTTGGTAGCAGTTCTATCTAAGGCTTAGAAAACTTCTACACACTTTGTTTTCTTATTAGAGACAAATTTGCTTTGGTCAGTGACCGTGTAAAAGCGGCATGTCTGGCCAGAGATTTTAACAAAACTCATTTTCATTTTCCCCTGGGAAAATTGAGAACTTGATCTAATATTTTGTCAGCTTTAAAGAGTTGCGTAGCAGCTTTTCTAAATTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGATTTTCGTGAATCATTGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACCCTAGGGTTTGGTGATGGGCAATACTCTCGCAAGAGAGTTTGCTTGAAATGAATTGGCATGGGTTTTTGATATGAACTACGGCTGTTTATTCAATGTATTAGGTTTAATCCATCGTTGATTGACAACTGCTAGCGTCTTTCGAAATTTGGCCCTGCCTTAAAAACTTATCATAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCA

The 26S rDNA [D1,D2 region] of MYA-4465 lot 58228767

TTGGATCATTACGCCAGCATCCTAGGCAAAGCCGCAGACCTCAGTCCCGGTAGGCAATATCAACTGAGGCTATAATACTCCAAGGAGCTACATTCAACAGTCATTATCTTGCCACCAAAACTGATGCTGGCCCAGTAAAAAGCTAGAGCATAACACACGAGGAGTCATGATAACTAAATACCAAGTCTGATCAAATACCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCTTCACAGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCACTTTGAGCTGCATTCCCAAACAACTCGACTCTTCGAAAACATCTTACAAAGAAATGGACACCTCATCAGACGGGATTCTCACCCTCTATGACGTCCTGTTCCAAGGAACATAGACAAAGGCCAAATCCAAGATAGCTTTCTTCAAATTACAACTCGGGCACCGAAGGTACCAGATTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGCTACTAAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGT

Name of Depositor S Limtong
Special Collection ATCC
Chain of Custody
ATCC <-- S Limtong
Isolation
Soil, Chonburi Province, Thailand.
Cross References

Nucleotide (GenBank) : JN863710 RPB 2 gene

Nucleotide (GenBank) : JN863703 RPB 1 gene

Nucleotide (GenBank) : FJ914941 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914924 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : FJ914910 18S rRNA gene

References

Limtong S, et al. Ogataea chonburiensis sp nov and Ogataea nakhonphanomensis sp nov., thermotolerant, methylotrophic yeast species isolated in Thailand, and transfer of Pichia siamensls and Pichia thermomethanolica to the genus Ogataea. Int. J. Syst. Evol. Microbiol. 58: 302-307, 2008.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation