Saagaromyces sp. (ATCC® MYA-3874)

Strain Designations: M208  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations M208
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Medium Medium 790: By+ medium
Growth Conditions
Temperature: 25.0°C
Sequenced Data
>ITS DNA sequence for MYA-3874

CAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTCATGACTCCAAACCCACTGTGAACCTACCCGACGCCTCGGCGGGCGGGCCCCTGGGGGGGCCCGCAGGCGCAAGCCGCCCGCCGCAGGACAGACTCTCACAGGGCGAAATACCTTCTGAGTGGTACTAAAAACAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGCACTCCGGCGGGCATGCCTGTTCGAGCGTCATCTCAAACCCCTCAGGCCACGCCTGGTGCTGGGGGCCCGCGACCCGTAGCGGCCGCGGCCCCTAAAATACAGCGGCGGCACGCCCCGGCGCCCCCTGCGAAGTCGCTAAACCTCGCTTCGGGCCGCCCCGGCGCCAGCCACCCCAAGACGAGGCGCCGCCGCGCGCGGCAGCCCGCTGGTTTGACCTCGGATCAGGTAG

>D1D2 DNA sequence for MYA-3874

TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGAGGCGCCTTCCGAGTGCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTACGGCCGGCCGCCGAGCCTCTGTGAAGCTCCTTCGAAGAGTCGAGTAGTTTGGGAATGCTGCTCTAAGCGGGAGGTATACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACCTGCGCCCGGCGGCTCAGCTGGCGTTCTCGCCAGTGCACTCCGCCGGCTCAGGCCAGCATCGGTTCGCCGCTGGGGAGAACGGCGGCGGGAATGTGGCTCTTCGGAGTGTTATAGCCCGCCGCCATGCCCTCCGGCGGACCGAGGTTCGCGCACCGCAAG

Name of Depositor HP Molitoris
Special Collection ATCC
Chain of Custody
ATCC <-- HP Molitoris
References

Rohrmann S, Molitoris P. Screening for wood degrading enzymes in marine fungi. Can. J. Bot. 70: 2116-2123, 1992.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation