Halosphaeria mediosetigera var. mediosetigera Cribb & J.W. Cribb (ATCC® MYA-3865)

Strain Designations: M180  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations M180
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments
Species ID questionable; The D1D2 sequence of 28S rDNA indicates that the strain is phylogenetically close to Acremonium spp.
Medium ATCC® Medium 790: By+ medium
Growth Conditions
Temperature: 25.0°C
Sequenced Data
>28S ribosomal RNA gene, partial sequence:

AAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAA GCGGCAACAGCTCAAATTTGAAATCTGGCCGCAAGGTCCG AGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTC

CGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCC CGTACGGTAGGACCACCAAGCCTCTGTAAAGCTCCTTCGA CGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGT

GTACGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAG CGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGC

ATTCATGACCAGACTTGGGCTTGGTTGAACATCCGGCGTT CTCGCCGGTGCACTCTGCCAGTCCAGGCCAGCATCAGTTT GCCCCGGGGGATAAAGGCGGCGGGAATGTGGCTCCCTTCG

GGGAGTGTTATAGCCCGTCGTGTAATGCCCTGGGGCGGAC TGAGGAACGCGCTTCGGCACGGATGCTGGCGTAATGG

Name of Depositor HP Molitoris
Special Collection ATCC
Chain of Custody
ATCC <-- HP Molitoris
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation