Halosphaeria mediosetigera var. mediosetigera Cribb & J.W. Cribb (ATCC® MYA-3865)

Strain Designations: M180  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations M180
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
Species ID questionable; The D1D2 sequence of 28S rDNA indicates that the strain is phylogenetically close to Acremonium spp.
Medium Medium 790: By+ medium
Growth Conditions
Temperature: 25.0°C
Sequenced Data
>28S ribosomal RNA gene, partial sequence:

AAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAA GCGGCAACAGCTCAAATTTGAAATCTGGCCGCAAGGTCCG AGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTC

CGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCC CGTACGGTAGGACCACCAAGCCTCTGTAAAGCTCCTTCGA CGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGT

GTACGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAG CGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAA AAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGC

ATTCATGACCAGACTTGGGCTTGGTTGAACATCCGGCGTT CTCGCCGGTGCACTCTGCCAGTCCAGGCCAGCATCAGTTT GCCCCGGGGGATAAAGGCGGCGGGAATGTGGCTCCCTTCG

GGGAGTGTTATAGCCCGTCGTGTAATGCCCTGGGGCGGAC TGAGGAACGCGCTTCGGCACGGATGCTGGCGTAATGG

Name of Depositor HP Molitoris
Special Collection ATCC
Chain of Custody
ATCC <-- HP Molitoris
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation