Remispora trullifera Kohlm. (ATCC® MYA-3864)

Strain Designations: M194  /  Product Format: frozen

Deposited As Halosarpheia trullifera (Kohlm.) Jones et al.
Strain Designations M194
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 790: By+ medium
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
>ITS DNA sequence for MYA-3864

ATCATTAGCGAGTTATTACCAACTCCAAACCCTTGCGAATCGTTGGAAGCCTGTATACTTGCCGGTGCTACCTAATTTCGGCGGGTGTGGGGGTTCCGCGGACACCTGTCCCGGTTCCCTCCCGGGAAACCAGCCCGCCGGAAGCGCCAAAACACTACGTATCTTATTGGCGTTTTTTTTATCCACTGAGTGGTGTAATGAAGAAGTTACAAAACAAAACAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGGAGCGAAATCCGATAAGTAATGCGAATTGCAGATTTCAGCGAGTCATCGAATCTTTGAACGCACATTGCACCCGGTGGTATTCCGCCGGGTATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCACCCGCCCGTCAAGGCGTGGGAGAATAGGCCTGGTGTTGGGGCGCTGCAGCCCTATGATGGGCTGCAGGCTCCGAAAACTAGTGGCGCACCTGCCGGCGGTAGCCCCTGCGTAGTAGAACTTTCAACCTCGCATCGGTTCCCGGCGGCGTGCAGCCCAAACGGCGGAAGCCAATTTATCTCAGTTGACCTCGAATCAG

>D1D2 sequence for MYA-3864

CTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCAGGCCCGAGTTGTAATTTGCAGAGGAAGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGATACGGGACGCCATAGAGGGTGAGAGCCCCGTACGGTCTGGTGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAACTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCTGGCAGCTTAGCCGTCCTTCTGGGCGGTGTACTCTGCCGGCTCAGGCCAGCATCAGTTTCGGGCAGGGGAGAAATGCGGCGGGAATGTGGCTCTTCGGAGTGTTATAGCCCGCTGTTATGCCCTGCCGGGGACTGAGGTTCGCGCTCTGCACGGATGCTGG

Name of Depositor HP Molitoris
Special Collection ATCC
Chain of Custody
ATCC <-- HP Molitoris