Remispora trullifera Kohlm. (ATCC® MYA-3864)

Strain Designations: M194  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Halosarpheia trullifera (Kohlm.) Jones et al.
Strain Designations M194
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 790: By+ medium
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
>ITS DNA sequence for MYA-3864

ATCATTAGCGAGTTATTACCAACTCCAAACCCTTGCGAATCGTTGGAAGCCTGTATACTTGCCGGTGCTACCTAATTTCGGCGGGTGTGGGGGTTCCGCGGACACCTGTCCCGGTTCCCTCCCGGGAAACCAGCCCGCCGGAAGCGCCAAAACACTACGTATCTTATTGGCGTTTTTTTTATCCACTGAGTGGTGTAATGAAGAAGTTACAAAACAAAACAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGGAGCGAAATCCGATAAGTAATGCGAATTGCAGATTTCAGCGAGTCATCGAATCTTTGAACGCACATTGCACCCGGTGGTATTCCGCCGGGTATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCACCCGCCCGTCAAGGCGTGGGAGAATAGGCCTGGTGTTGGGGCGCTGCAGCCCTATGATGGGCTGCAGGCTCCGAAAACTAGTGGCGCACCTGCCGGCGGTAGCCCCTGCGTAGTAGAACTTTCAACCTCGCATCGGTTCCCGGCGGCGTGCAGCCCAAACGGCGGAAGCCAATTTATCTCAGTTGACCTCGAATCAG

>D1D2 sequence for MYA-3864

CTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCAGGCCCGAGTTGTAATTTGCAGAGGAAGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGATACGGGACGCCATAGAGGGTGAGAGCCCCGTACGGTCTGGTGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAACTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCTGGCAGCTTAGCCGTCCTTCTGGGCGGTGTACTCTGCCGGCTCAGGCCAGCATCAGTTTCGGGCAGGGGAGAAATGCGGCGGGAATGTGGCTCTTCGGAGTGTTATAGCCCGCTGTTATGCCCTGCCGGGGACTGAGGTTCGCGCTCTGCACGGATGCTGG

Name of Depositor HP Molitoris
Special Collection ATCC
Chain of Custody
ATCC <-- HP Molitoris
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation