Oculimacula sp. (ATCC® MYA-3860)

Strain Designations: M194  /  Product Format: frozen

Deposited As Flagellospora curvula Ingold
Strain Designations M194
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
ITS DNA sequences indicate that this strain is very close to Oculimacula yallundae and O. acuformis.
Medium Medium 790: By+ medium
Growth Conditions
Temperature: 20.0°C
Sequenced Data
>ITS DNA sequence for MYA-3860

AGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATAGAGCAATGGATAGACAGCGCCCCGGGAGAAATCCTGGGGGCTACCCTACTTCGGTAAGGTTTAGAGTCGTCGGGCCTCTCGGAGAAGCCTGGTCCAGACCTCCACCCTTGAATAAATTACCTTTGTTGCTTTGGCAGGGCGCCTCGCGCCAGCGGCTTCGGCTGTTGAGTACCTGCCAGAGGACCACAACTCTTGTTTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTATAACCACTCAAGCTCTCGCTTGGTATTGGGGTTCGCGTCTTCGCGGCCTCTAAAATCAGTGGCGGTGCCTGTCGGCTCTACGCGTAGTAATACTCCTCGCGATTGAGTCCGGTAGGTTTACTTGCCAGCAACCCCCAATTTTTTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCAT

Name of Depositor HP Molitoris
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- HP Molitoris