Oculimacula sp. (ATCC® MYA-3860)

Strain Designations: M194  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Flagellospora curvula Ingold
Strain Designations M194
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
ITS DNA sequences indicate that this strain is very close to Oculimacula yallundae and O. acuformis.
Medium ATCC® Medium 790: By+ medium
Growth Conditions
Temperature: 20.0°C
Sequenced Data
>ITS DNA sequence for MYA-3860

AGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATAGAGCAATGGATAGACAGCGCCCCGGGAGAAATCCTGGGGGCTACCCTACTTCGGTAAGGTTTAGAGTCGTCGGGCCTCTCGGAGAAGCCTGGTCCAGACCTCCACCCTTGAATAAATTACCTTTGTTGCTTTGGCAGGGCGCCTCGCGCCAGCGGCTTCGGCTGTTGAGTACCTGCCAGAGGACCACAACTCTTGTTTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTATAACCACTCAAGCTCTCGCTTGGTATTGGGGTTCGCGTCTTCGCGGCCTCTAAAATCAGTGGCGGTGCCTGTCGGCTCTACGCGTAGTAATACTCCTCGCGATTGAGTCCGGTAGGTTTACTTGCCAGCAACCCCCAATTTTTTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCAT

Name of Depositor HP Molitoris
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- HP Molitoris
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation