Ogataea polymorpha (Morais et Maia) Yamada, Maeda et Mikata, teleomorph (ATCC® 76760)

Strain Designations: 125-2E  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Hansenula polymorpha de Morais et Maia, teleomorph
Strain Designations 125-2E
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
Peroxisome-deficient
Ethanol metabolism
Medium Medium 1245: YEPD
Growth Conditions
Temperature: 24.0°C
Sequenced Data
>ITS of ATCC 76760 TTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTCTAAGCTGGAGCTGCTGATCGACTGAACTGTTTGCCTGCGCTGCTGAAATATTGCGTGCGCGGCGATGGTTTTTTTGGTTGCAGTTCTACTCAAGGCTTAGAAATCTCCTTACACACTTTGTTTTCTTATTAGAGACAAATTTGCTTTGGCTAGCGGTCGCTTAAGCGCGGCATGGCTGGCCAGAGGTTTTAACAAAACTCATTTTCGTCTTGCCCATGTGGGGAAGACTGAAAACTTGTATTATGATTTTGTCAGTTATAAGAAGTTGCGTTTGCAGCTTTTCTAAACTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGATTTTCGTGAATCATTGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACCCTCGGGTTTGGTGATGGGCAATACTCTCTTTTCTGAGAGTTTGCTTGAAATGAATTGGCATGAGTTTTTGATACGAACTTCAGCTGTTTATTCAATGTATTAGGTTTTATCCATCGTTGATTGACAACTGCAAGCTTCTTTCAAAAATTGGCTCTGCCTTACAAACTTTAATCATAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAAT

//

>D1/D2 region of LSU rDNA of ATCC 76760

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGAAGAAAGCTATCTTGGAGGTGGCCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGATGAGGTGTCCATTTCCGTGTAAGATGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCAGACTTGGTATTTAGCTATCATCGCTCCTTGTGGGTGGTGCTCTAGCTTTTTACTGGGCCAGCATCAGTTTTGGTGGCAAGATAATGACAGTTGAATGTGGCTCCTCGGAGTGTTATAGCTTCTGTTGATGTTGCCTACCGAGACTGAGGTCTGCGGCTTTTGCCTAGGATGCTGGCGTAATGATCCAATACCGCCCGT

//

Name of Depositor M Veenhuis
Cross References

Nucleotide (GenBank) : FJ914936 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914919 ITS including 5.8S rRNA gene

References

Cregg JM, et al. Peroxisome-deficient mutants of Hansenula polymorpha. Yeast 6: 87-97, 1990.

van der Klei IJ, et al. Methanol metabolism in a peroxisome-deficient mutant of Hansenula polymorpha: a physiological study. Arch. Microbiol. 156: 15-23, 1991. PubMed: 1772343

van der Klei IJ, et al. Selective inactivation of alcohol oxidase in two peroxisome-deficient mutants of the yeast Hansenula polymorpha. Yeast 7: 813-821, 1991. PubMed: 1789002

. . FEMS Microbiol. Lett. 82: 297-302, 1991.

Suh SO, Zhou JJ. Methylotrophic yeasts near Ogataea (Hansenula) polymorpha: a proposal of Ogataea angusta comb. nov. and Candida parapolymorpha sp.nov. FEMS Yeast Res. 10: 631-638, 2010. PubMed: 20491937

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation