Dactylospora haliotrepha (Kohlmeyer et Kohlmeyer) Hafellner (ATCC® 66950)

Strain Designations: 5300B  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Dactylospora haliotrepha (Kohlmeyer et Kohlmeyer) Hafellner
Strain Designations 5300B
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium Medium 350: Emerson YpSs agar
Growth Conditions
Temperature: 24°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAAACGACTTGGGTAGTCACTGCCCAAACTCAAACCCTATGATTTGGTTCCCAGATGCTTCTTTGCCGGTGTCTGCCGGCAGAAGAACTCCCAAACACGGTCATGAAACAGTGTTCTGAAATTTCAAACAGCAAAAGTGAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAGGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATGGCGCCCCCCGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTACCCTCAAACCGCCGGTTTGTTGTTGGGTGTCCGCCGTGAAGGCCGCGCCTGAAAGGTAGGGGTGGGTGATCGATCAACCACGGGCGCACAGATGTCGCCATGCAGGCTGACGGTCATCCATAATTTACACGGGGTGTGTATTCTGAACGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGACCTTCCGGGTCCGAGTTGTAATTTGGAGAGGATGTTTCGGGTAAGACCCGGGCCTAAGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCCAGGGTTGCACCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGAAGCCAGACTCGTTTGCGGGGTTCAACCGTCGTTCTCGGCGGTGCATTTCCCCGCTGTCGGGCCAGCATCGGTTCGGGTGGAAGGTCAAAGGCCCTGGGAACGTGACACCCTCCGGGATGTTTTATAGCCCTCGGCGTAATGCTTCCCACCTGGACTGAGGCACGCGTTCGCTAGGATGCTGGCGTAATGGCTTTCAGCGAC

Name of Depositor J Kohlmeyer
Isolation
Intertidal wood, Lizard Island, Queensland, Australia.
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation