Dactylospora haliotrepha (Kohlmeyer et Kohlmeyer) Hafellner (ATCC® 66950)

Strain Designations: 5300B  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Dactylospora haliotrepha (Kohlmeyer et Kohlmeyer) Hafellner
Strain Designations 5300B
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium ATCC® Medium 350: Emerson YpSs agar
Growth Conditions
Temperature: 24°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAAACGACTTGGGTAGTCACTGCCCAAACTCAAACCCTATGATTTGGTTCCCAGATGCTTCTTTGCCGGTGTCTGCCGGCAGAAGAACTCCCAAACACGGTCATGAAACAGTGTTCTGAAATTTCAAACAGCAAAAGTGAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAGGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATGGCGCCCCCCGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTACCCTCAAACCGCCGGTTTGTTGTTGGGTGTCCGCCGTGAAGGCCGCGCCTGAAAGGTAGGGGTGGGTGATCGATCAACCACGGGCGCACAGATGTCGCCATGCAGGCTGACGGTCATCCATAATTTACACGGGGTGTGTATTCTGAACGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGACCTTCCGGGTCCGAGTTGTAATTTGGAGAGGATGTTTCGGGTAAGACCCGGGCCTAAGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCCAGGGTTGCACCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGAAGCCAGACTCGTTTGCGGGGTTCAACCGTCGTTCTCGGCGGTGCATTTCCCCGCTGTCGGGCCAGCATCGGTTCGGGTGGAAGGTCAAAGGCCCTGGGAACGTGACACCCTCCGGGATGTTTTATAGCCCTCGGCGTAATGCTTCCCACCTGGACTGAGGCACGCGTTCGCTAGGATGCTGGCGTAATGGCTTTCAGCGAC

Name of Depositor J Kohlmeyer
Isolation
Intertidal wood, Lizard Island, Queensland, Australia.
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation