Halophytophthora kandeliae Ho et al. (ATCC® 66501)

Strain Designations: T0928-5V [IFO 32620]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations T0928-5V [IFO 32620]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology On V8 medium at 25°C after 14 days, mycelium white, cottony, forming a rosette pattern out from the plug, moderately dense. Hyphae hyaline, guttulate. Sporangia hyaline, subglobose to oblong, smooth.
Medium Medium 343: V8 juice agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TTGTTTGGACACGTTGGGCTTCGTTGGCGGCTTCCCTTGTGGTTGTCGTCGGCTTGAGGCTATCAGATGGCTTTGTTGCTTGGTTGGTTGATTGGTTGATTGGTTGCTCCGTCAATCGGTCGTTCTCGAACGAGTGCTAAAGCGGTCTTTTTGTAAACCCATTGTGATATTGAAACTGATTGTACTGTGGGGACGAAAGTCTCTGCTTTGAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTTTGCCTGGAAGTATGTCTGTATCAGTGTCCGTAGACTAAACTTGCCTTTCTTGCGTCGTGTAGTCGTCGGTTGGAAAGAGCAGATGTGAGGTGTSTTGCGCGGTCTGCATGGCTTGGCTCCGGTCGGGTCTGTTTGTTTTGCGCAAGTCCCTTTAAAGTCGGACGTGTTTCTCTGTGTGGTGCGCGGTGACGGATCTGTGGACGTGCGTGCGTGCGGGACGACAATGTTGTGCGCGGACGAGTCTGGCGGTCTTTGGTGCTTGCACTGTTGGGATTCCTCGATTGGCGGTATGTTTGGCCTCGGCTTTGACAATGCAGCTTATTGGGTGTTTCTCTGCGCGGCTTGTGCTGTATGAAGACGAACCGGATGGTCTGTGTGTGTGCGTTGTGTGTGTCTGTGCGTTCGTTCGTTTGCGAAGAGCCGTTTGTATGCGTGTGTCATGCATGGAGCGTGGTATATTTGGGAAGTTGTGCTGGTGTCGGCTTTCGGGTCGGTGTGA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATGGACGCGTAATCAGTGCGGCTGTTGGGGCGAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATGCCCTTGCACGTTGCACGTACGATTCGTGGTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGCAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGTTCGTTGCCAGTGTCTGTAATCGTCGGCATATTTCATTGCTGTGCGGGAGTGTGTCGCGCGTTGGCAGTAGTTTGTTCTGCGCCTCGCGTGTCGTTGGCTCGTGCTCGGCGGTGCCCTGTGTCGGCGTGTGACGTCAGAGTGAGTTCGTATGGTGCGGGAAATGGCGGTCTAGGAGGTAGGTCAGGAGCTTGCTTTTGGCTGTTATATCTGGGCATGCTAGTTGTCGTGGCTGGGACTGAGGTGCGTACAACGTGCTTTTGGAGTGTTGGTGCGTCTCTGTGTGCGTGCGTGTTGGATAGCTTGCTATGCAGTGTGCGTTGCGTGCGGATGGTCGTGCTTGGTAACTCTTTGCCGTTCGGGACTTTGACGAAATGGCGCGATCCGA

Morphology On V8 medium at 25°C after 14 days, mycelium white, cottony, forming a rosette pattern out from the plug, moderately dense. Hyphae hyaline, guttulate. Sporangia hyaline, subglobose to oblong, smooth.
Name of Depositor HH Ho
Isolation
Kandelia candel leaves submerged in seawater, Tungshiao, Taiwan.
References

Ho HH, et al. Halophytophthora kandeliae, a new marine fungus from Taiwan. Mycologia 83: 419-424, 1991.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation