Ogataea polymorpha (Morais et Maia) Yamada, Maeda et Mikata, teleomorph (ATCC® 66057)

Strain Designations: p-5  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Hansenula polymorpha de Morais et Maia, teleomorph
Strain Designations p-5
Application
produces alcohol dehydrogenase
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
>ITS of ATCC 66057 TTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTCTAAGCTGGAGCTGCTGATCGACTGAACTGTTTGCCTGCGCTGCTGAAATATTGCGTGCGCGGCGATGGTTTTTTTGGTTGCAGTTCTACTCAAGGCTTAGAAATCTCCTTACACACTTTGTTTTCTTATTAGAGACAAATTTGCTTTGGCTAGCGGTCGCTTAAGCGCGGCATGGCTGGCCAGAGGTTTTAACAAAACTCATTTTCGTCTTGCCCATGTGGGGAAGATTGAAAACTTGTATTATGATTTTGTCAGTTATAAGAAGTTGCGTTTGCAGCTTTTCTAAACTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGATTTTCGTGAATCATTGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACCCTCGGGTTTGGTGATGGGCAATACTCTCTTTTCTGAGAGTTTGCTTGAAATGAATTGGCATGAGTTTTTGATACGAACTTCAGCTGTTTATTCAATGTATTAGGTTTTATCCATCGTTGATTGACAACTGCAAGCTTCTTTCAAAAATTGGCTCTGCCTTACAAACTTTAATCATAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAAT

//

>D1/D2 region of LSU rDNA of ATCC 66057

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGAAGAAAGCTATCTTGGAGGTGGCCTTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGATGAGGTGTCCATTTCCGTGTAAGATGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCAGACTTGGTATTTAGCTATCATCGCTCCTTGTGGGTGGTGCTCTAGCTTTTTACTGGGCCAGCATCAGTTTTGGTGGCAAGATAATGACAGTTGAATGTGGCTCCTCGGAGTGTTATAGCTTCTGTTGATGTTGCCTACCGAGACTGAGGTCTGCGGCTTTTGCCTAGGATGCTGGCGTAATGATCCAATACCGCCCGT

//

Name of Depositor HY Fang
Chain of Custody
ATCC <<--HY Fang<<--L.M. Wu
Isolation
soil, Taiwan
Cross References

Nucleotide (GenBank) : FJ914935 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914918 ITS including 5.8S rRNA gene

References

Huang TL, et al. Oxidation of secondary alcohols to methyl ketones by immobilized yeast cells. J. Gen. Appl. Microbiol. 31: 125-134, 1985.

Suh SO, Zhou JJ. Methylotrophic yeasts near Ogataea (Hansenula) polymorpha: a proposal of Ogataea angusta comb. nov. and Candida parapolymorpha sp.nov. FEMS Yeast Res. 10: 631-638, 2010. PubMed: 20491937

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation