Gaeumannomyces graminis (Saccardo) von Arx et Olivier (ATCC® 64419)

Strain Designations: ZOY-Ggg  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations ZOY-Ggg
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium Medium 323: Malt agar medium
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTAAAGAGTTGAAAAACTCCAACCCCTGTGAACCTACCTTTACTGTTGCTTCGGCGGAATATGGCCCCCCGGGCCGGACGTCGCCGGAGGTTACAAACCCTGAATTTTAGTGTATCTCTGAGCACAAAACCAAATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGTATTCCGGCGGGCATGCCTGTCCGAGCGTCATTTCACCACTCAAGCCCAGCTTGGTGTTGGGGCACCCGGCCGCCCGGCGGTCGGGGCCCCCAAGAACATCGGCGGTCTCGCCAGGACCCTGAACGCAGTAACTCGCGGTAAAACGCGCTTCGTTCGGAGGCTTTCCCGGCGGGCTCCAGCCGCTAAACCCCCTAAACTTCTTAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTAGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCATCCAGCGTTCTCGCTGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGA

Name of Depositor PJ Landschoot
Isolation
Zoysia sp., Virginia
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation