Gaeumannomyces graminis (Saccardo) von Arx et Olivier (ATCC® 64419)

Strain Designations: ZOY-Ggg  /  Product Format: frozen

Strain Designations ZOY-Ggg
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium ATCC® Medium 323: Malt agar medium
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTAAAGAGTTGAAAAACTCCAACCCCTGTGAACCTACCTTTACTGTTGCTTCGGCGGAATATGGCCCCCCGGGCCGGACGTCGCCGGAGGTTACAAACCCTGAATTTTAGTGTATCTCTGAGCACAAAACCAAATAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGTATTCCGGCGGGCATGCCTGTCCGAGCGTCATTTCACCACTCAAGCCCAGCTTGGTGTTGGGGCACCCGGCCGCCCGGCGGTCGGGGCCCCCAAGAACATCGGCGGTCTCGCCAGGACCCTGAACGCAGTAACTCGCGGTAAAACGCGCTTCGTTCGGAGGCTTTCCCGGCGGGCTCCAGCCGCTAAACCCCCTAAACTTCTTAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTAGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCATCCAGCGTTCTCGCTGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGA

Name of Depositor PJ Landschoot
Isolation
Zoysia sp., Virginia