Pachysolen tannophilus Boidin et Adzet, teleomorph (ATCC® 60393)

Strain Designations: NO3-NO3-4 [NRRL Y-12886]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NO3-NO3-4 [NRRL Y-12886]
Application
Bioethanol production
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Morphology

After 3 days colony appears mucoid to butyrous and tannish-white. Yeast cells are spheroidal to ellipsoidal, (1.5-5.0) x (2.0-7.0) µm.

Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
      18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGATCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCG

TGCGATGGGGAATCCAGATCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTTGGATCAGACTTGGTGTTTAGTACTCTTCACTCCTTGTGGGTGGGGCTCTTGCTTTATACTGGGCTAGCATCGGTTTGGGTGGTAGGATAATGACATTGGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCCTTTGTTGATACTACCTACCTAGACCGAGGACTGCGTC

Morphology

After 3 days colony appears mucoid to butyrous and tannish-white. Yeast cells are spheroidal to ellipsoidal, (1.5-5.0) x (2.0-7.0) µm.

Name of Depositor TW Jeffries
Isolation
mutant derived from ATCC 32691
Cross References

Nucleotide (GenBank) : JQ070157 D1/D2 region of 28S rRNA gene

References

Jeffries TW. Mutants of Pachysolen tannophilus showing enhanced rates of growth and ethanol formation from D-xylose. Enzyme Microb. Technol. 6: 254-258, 1984.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation