Pachysolen tannophilus Boidin et Adzet, teleomorph (ATCC® 60393)

Strain Designations: NO3-NO3-4 [NRRL Y-12886]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations NO3-NO3-4 [NRRL Y-12886]
Application
Bioethanol production
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Morphology

After 3 days colony appears mucoid to butyrous and tannish-white. Yeast cells are spheroidal to ellipsoidal, (1.5-5.0) x (2.0-7.0) µm.

Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
      18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGATCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCG

TGCGATGGGGAATCCAGATCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTTGGATCAGACTTGGTGTTTAGTACTCTTCACTCCTTGTGGGTGGGGCTCTTGCTTTATACTGGGCTAGCATCGGTTTGGGTGGTAGGATAATGACATTGGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCCTTTGTTGATACTACCTACCTAGACCGAGGACTGCGTC

Morphology

After 3 days colony appears mucoid to butyrous and tannish-white. Yeast cells are spheroidal to ellipsoidal, (1.5-5.0) x (2.0-7.0) µm.

Name of Depositor TW Jeffries
Isolation
mutant derived from ATCC 32691
Cross References

Nucleotide (GenBank) : JQ070157 D1/D2 region of 28S rRNA gene

References

Jeffries TW. Mutants of Pachysolen tannophilus showing enhanced rates of growth and ethanol formation from D-xylose. Enzyme Microb. Technol. 6: 254-258, 1984.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation