Kloeckera japonica Saito et Ohtani (ATCC® 58370)

Alternate State: Hanseniaspora valbyensis Klocker, teleomorph  /  Strain Designations: NRRL Y-1382 [CBS 281]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NRRL Y-1382 [CBS 281]
Alternate State Hanseniaspora valbyensis Klocker, teleomorph
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GCGGAAGGATCATTAGATTGAATTATCATTTTGTTGCTCGAGTTCTTTTAAGATCTTTTACAATTTAAATGGGTTGTCTTTGTTTGAGATGTGCGCTTAATTGCGCTGCTTATTCAGAGGCTCTCAGTAGAAGTAATTTTTAATTGAATCTCAGTCAACTACTACACACAGTGGAGTTTTCTACTTAATTCTTTCTACTTTGGGTCGCAAGATCCAAGGTAAAAACAAACACAAACAATTTTTTTTATTATAATTTTTTAAGCTAAACCAAAATTCCTAACGGAAATTTTAAATAATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCGAATTGCGATAAGTAATGTGAATTGCAGATACTCGTGAATCATTGAATTTTTGAACGCACATTGCGTCCTCAGGTATTCCTGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAAAGAATATTTTATTATTTTTTTGGTAGTGAGCGATACTCAGGGTTAGCTTGAAATTGAAGATTTTTGTAATCTTTAATAATTCAACACTTAGCTTCTTTGGAGACGCTGTTCTCGCTGTGATGTATTTATGGATTCGTCTATTTTTTACATTTGCAAGGGATTCGGTAAAGTACCTTAGGCAAAGAGTTGTTTTTAATACTCATCAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATA

Name of Depositor NRRL
Isolation
Tree exudate; Japan
References

Saito K. On some fermentative yeasts isolated from sap exuded from tree trunks. J. Ferment. Technol. 9: 6-11, 1931.

VITEK 2 YST Comprehensive QC Set. bioMerieux.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation