Acremonium butyri (van Beyma) Gams, anamorph (ATCC® 52620)

Alternate State: Nectria viridescens Booth, teleomorph  /  Strain Designations: 67  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 67
Alternate State Nectria viridescens Booth, teleomorph
Application
produces ovicide
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
Nematocide
Morphology

After 5 days at 25°C colonies finely floccose, turning deep olive to black with heavy sporulation. Conidia smooth, ellipsoidal to globose 4-5.3 X 2.5-3.7µm.

Medium ATCC® Medium 323: Malt agar medium
Growth Conditions
Temperature: 24.0°C
Sequenced Data
       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ATGCATCTACTGATCGAGGTCACCTTCAGAAGTGGGGGGTTTAACGGCGTGGCCAGGCTGCGTTCCGGTGCGAGGTGTGCTACTACGCAGAGGAGGCTACAGCGAGACCGCCACTAGATTTCGGGGCCGGCGCGCCGGAGAGGGCGGCCGATCCCCAACACCAAGCCCGGGGGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTATTTGCTTATGTTACTCAGAAGATACTCATGAAAGACAAGAGTTTGGGTCCTCCGGCGGGCGCCTGGGTCCGGGCCCGAGGGCGCCGGGGCGATCCCGCCGAAGCAACAATAGGTATGTTCACAGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGA

   Large subunit ribosomal RNA gene, partial sequence.

AAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGAGCCCGGTTAATCATCCAGCCTTCTGGCTGGTGCACTTGGCCGGCTCAGGCCAGCATCAGTTCGGCGCGGGGGATAAAGGCTTCGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGTGTAATACCCTGTACTGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTA

Morphology

After 5 days at 25°C colonies finely floccose, turning deep olive to black with heavy sporulation. Conidia smooth, ellipsoidal to globose 4-5.3 X 2.5-3.7µm.

Name of Depositor H Lysek
Isolation
soil, USSR
Cross References

Nucleotide (GenBank) : JQ070164 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JQ070093 ITS including 5.8S rRNA gene

References

Kunert J, et al. Polysaccharide-hydrolyzing activity of ovicidal fungi. Biologia 37: 291-299, 1982.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation