Acremonium butyri (van Beyma) Gams, anamorph (ATCC® 52620)

Alternate State: Nectria viridescens Booth, teleomorph  /  Strain Designations: 67  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 67
Alternate State Nectria viridescens Booth, teleomorph
Application
produces ovicide
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
Nematocide
Morphology

After 5 days at 25°C colonies finely floccose, turning deep olive to black with heavy sporulation. Conidia smooth, ellipsoidal to globose 4-5.3 X 2.5-3.7µm.

Medium ATCC® Medium 323: Malt agar medium
Growth Conditions
Temperature: 24.0°C
Sequenced Data
       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ATGCATCTACTGATCGAGGTCACCTTCAGAAGTGGGGGGTTTAACGGCGTGGCCAGGCTGCGTTCCGGTGCGAGGTGTGCTACTACGCAGAGGAGGCTACAGCGAGACCGCCACTAGATTTCGGGGCCGGCGCGCCGGAGAGGGCGGCCGATCCCCAACACCAAGCCCGGGGGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTATTTGCTTATGTTACTCAGAAGATACTCATGAAAGACAAGAGTTTGGGTCCTCCGGCGGGCGCCTGGGTCCGGGCCCGAGGGCGCCGGGGCGATCCCGCCGAAGCAACAATAGGTATGTTCACAGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGA

   Large subunit ribosomal RNA gene, partial sequence.

AAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGAGCCCGGTTAATCATCCAGCCTTCTGGCTGGTGCACTTGGCCGGCTCAGGCCAGCATCAGTTCGGCGCGGGGGATAAAGGCTTCGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGTGTAATACCCTGTACTGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTA

Morphology

After 5 days at 25°C colonies finely floccose, turning deep olive to black with heavy sporulation. Conidia smooth, ellipsoidal to globose 4-5.3 X 2.5-3.7µm.

Name of Depositor H Lysek
Isolation
soil, USSR
Cross References

Nucleotide (GenBank) : JQ070164 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JQ070093 ITS including 5.8S rRNA gene

References

Kunert J, et al. Polysaccharide-hydrolyzing activity of ovicidal fungi. Biologia 37: 291-299, 1982.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation