Wallemia sebi (Fries) von Arx (ATCC® 42694)

Strain Designations: FRR 1471  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations FRR 1471
Application
Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM)
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Xerophilic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAAAACTCATAATCTTCTATACAAACCACTGTTTTAAAATGTTTACTAGAATGTCCAAGCAGTTAAGCTGTTGAAATATTAAAAGTTTRATAAAACTTTCAGCAACGGATCTCTTGGTTCAGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGATACAGTGAATCATCGAATCTTTGAACGCAAATGGCACTCTATGGTATTCCGTAGAGTACGTCTGTTTGAGCGTCGCGAACATCTCCATAATTAGTTTTTTTTAAATTGATTGTGGGTTTTGAGGTTGTCATATAAGCAATGACTCCCTTTAAAATAATTAGTGATGACCTTATGAATGGGTTAATACTGTGTGTTATAATGGATTACATCCATCACCAGTCAGAGAGTAATCTCGCCTTAGTAATTTGTAGTGATTGCTTCTAACTGCCATTGGCAAACAAACTGATCAAATCGACCTCAAATCAGATGGGATTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAAGCTGTTGTCTTTCAGGCAACCGCATTGTAATCTCAAGAAGTGTTTTCGATTGTAGCCTGCGTATAAGTACCTTGGAATAGGTTGGCATAGAGGGTGAAACTCCCGTCTTTGATGCAGATTACTATGATCATGTGATACACTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGAACGTGAAATTGCTGAAAGGGAAGCGTTTGAAGTTAGTCTGATAGGAGTTGTTCAATTGTTACTTTGGTTTCAATGTATGCAACTTTTTATCGGTCAACATCAATTTTGATTGATGGATAAAGGTAATAGGAATGTGGCTACAATTTGTAGTGTTATAGCCTATTATCATAAACATTGATTGAGATTGAGGACGGCAGTGTACCTTTTAGGAAGGTGTTCGCACCTATTACACTAAGGATGTTGACAAAATAGCTTTAAGCGAC

Name of Depositor AD Hocking
Chain of Custody
ATCC <-- AD Hocking <-- JI Pitt
Isolation
Bread, Australia
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation