Laetiporus sulphureus (Bulliard : Fries) Bondartsev et Singer (ATCC® 36049)

Strain Designations: 28  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Laetiporus sulphureus (Bulliard : Fries) Bondartsev et Singer
Strain Designations 28
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Isolation and purification
Medium ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAACGAACAACGGGGCCTCGCCCCTTGTCCACAAACACACCCCCGTGCACATCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTACACAAACTTCAGAATGTATATCGGAATGTCTTACGCGTTGTAACGCATCGTAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGTTGCCGGACGCGCGTTCGGCTCCTCTTGAATGCATAGTAAAGCTTGGACCTGACCGACCGAGTGGACGTGATAGAAAGTCACCGTCGACTGAAGGGTCCGTCGTTGAACGGTTCAAGCTTTGTCTTCGGACGAAACATCTCTGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

AGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCTACGCCGGACCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCATGACACGGACCGCCGGCGGTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCCGGGGCTCAGCCTTGCATTCGTTTGCTCGGTTTACTTCCCGGTCGACGGGCCAGCGTCGATTTTGACCGTCGGAGAAGGGTCAGGGGAAAGTGGCACCTTCGGGTGTGTTATAGCCTTTGGTCGCATACGGCGGTTGGGATCGAGGAACGCAGCACGCCTTTATGGCCGGGGCCTTTGTGCCCAAGTACCGTGCT

Name of Depositor A Ginterova
Isolation
Oak stump, Czechoslovakia
References

Ginterova A, Janotkova O. A simple method of isolation and purification of cultures of wood- rotting fungi. Folia Microbiol. 20: 519-520, 1975. PubMed: 289

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation