Xeromyces bisporus Fraser (ATCC® 28298)

Strain Designations: FRR 25  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Monascus bisporus (Fraser) von Arx
Strain Designations FRR 25
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Heat-resistant xerophile
Medium ATCC® Medium 319: Harrold's M40Y
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCCGAACTTACTTCGGGGCCCTACCTCCGACCCGTGACTACCGAACCTCTGTTGCTTCGGCGTGTTGGCCTCGTCCCACGAGGCGGCGCCGGAGACCTTCTCCTGAACGCTTATTTATTTTGAAGGGAATTGCAGTCTGAGTCGAAACGATACAAATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCTCAAGCAACGGCTTGTGTGTTGGGCCGCCGTCCTCGCCGTAACTTCGCGCGGGGACGGGTCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCCGTAGGCCGGCTCGGCGCCCGCCCAACCTCATTATATTCTTTCTGAAGGTTGACCTCGGATCAGGTAGGGATACCCGCCGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTCCGGGGTCCGCATTGTAATTTGGAGAGGATGCTTCGGGTGCGGCCCCCGTCTAAGTGCTCTGGAACGGGCCGTCGGAGAGGGTGAGAATCCCGTCTGGGGCGGGGAGCCCCGTGCCCGTGTGAAGCTCCTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACAGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTCGGACGGCCGGTCAAAGGCCCCCGGAATGTAGCGCCCCCCGGGGCGTCTTATAGCCGGGGGTGCCATGCGGCCAGTCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCGTAATGGTTGCAAGCGAC

Name of Depositor FRR
Isolation
Spoiled prunes, Australia
Cross References

Nucleotide (GenBank) : KU729046 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729134 D1/D2 region of 28S rRNA gene

References

Pitt JI, Christian JH. Heat resistance of xerophilic fungi based on microscopical assessment of spore survival. Appl. Microbiol. 20: 682-686, 1970. PubMed: 5485080

Park HG, Jong S-C. Molecular characterization of Monascus strains based on the D1/D2 regions of LSU rRNA genes. Mycoscience 44: 25-32, 2003.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation