Alternaria chartarum Preuss (ATCC® 26683)

Strain Designations: 503  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Alternaria humicola Oudemans
Strain Designations 503
Synonym Ulocladium chartarum (Preuss) Simmons
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Habitat
Morphology

Colonies spreading rapidly, reaching 6-8 cm diam in seven days at 25ºC. Conidiophores brown, forming conidia solitary or in short chains Conidia obclavate or with a beak, pale golden brown, mostly smooth-walled but sometimes minutely verruculose, muriform with four to seven transverse septa, 22-95 x 8-19 µm.

Medium Medium 340: Rabbit food agar
Medium 335: Potato carrot agar
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TTAGAAGAAATGTACCTCCCATTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGGGCTTTACACGGCAATAGCCAGCGACCACGTACGGGATTCTCACCCTCTGTGACGTCCTGTTCCAAGGAACTTGGACCGCTGCCAAAGCCAAAGCGCCCTCTGCAAATTACAACTCGGACTCTAAAAGAGCCAGATTTCAAATTTGAGCTGTTGCCGCTTCACTCGCCGTTACTAGGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAAAAGTTGAAAAAAAGGCTTAATGGATGCTAGACCTTTGCTGATAGAGAGTGCGACTTGTGCTGCGCTCCGAAACCAGTAGGCCGGCTGCCAATTACTTTAAGGCGAGTCTCCAGCAAAGCTAGAGACAAGACGCCCAACACCAAGCAAAGCTTGAGGGTACAAATGACGCTCGAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTGTAATTATTAATTTGTTACTGACGCTGATTGCAATTACAAAAGGTTTATGTTTGTCCTAGTGGTGGGCGAACCCACCAAGGAAACAAGAAGTACGCAAAAGACAAGGGTGAATAATTCAGCAAGGCTGTAACCCCGAGAGGTTCCAGCCCGCCTTCATATTTGTGTAATGATCCCTCCGCAGGTTCACCTACGGAGACCTTGTTACGACTTTTACT

Morphology

Colonies spreading rapidly, reaching 6-8 cm diam in seven days at 25ºC. Conidiophores brown, forming conidia solitary or in short chains Conidia obclavate or with a beak, pale golden brown, mostly smooth-walled but sometimes minutely verruculose, muriform with four to seven transverse septa, 22-95 x 8-19 µm.

Name of Depositor JW Phelps
Isolation
Sand, Wisconsin
References

Phelps JW. Microfungi in two Wisconsin sand blows. Trans. Br. Mycol. Soc. 61: 386-390, 1973.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation