Farrowia longicollea (Krzemieniewska et Bodura) Hawksworth, teleomorph (ATCC® 24603)

Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Chaetomium longirostre (Farrow) Ames, teleomorph
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
Perithecium development
Morphology

After 7 days at 25°C cultures growing fairly rapidly, aerial mycelium, when present, flocculose, white to pale orange, composed of hyaline hyphae mainly 1-3.5 µm diam. Cleistothecia 70-150 µm diam. with hairs to 150 µm long and 2.5-4 (-8) µm diam. at the base.

Medium Medium 340: Rabbit food agar
Growth Conditions
Temperature: 24.0°C
Sequenced Data
>D1/D2 region of 28S rRNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCGGCCCGAGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCACCGACCGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATGGTCGGACGCCTAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCCGGCTGATCATCTGGTGTTCTCACCAGTGCACTCTGCCGGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGACAAAGGCCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCAGGGCGCAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGAC.

//

>ITS region

GGGCGCCCGCCGGAGGTACACCAAACTCTTGCATTGTATGGCCTCTCTGAGTATTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCCGAAAACCAGTGGSGGGCTCGCTGTCACCCCGAGCGTAGTAGTTT

//

Morphology

After 7 days at 25°C cultures growing fairly rapidly, aerial mycelium, when present, flocculose, white to pale orange, composed of hyaline hyphae mainly 1-3.5 µm diam. Cleistothecia 70-150 µm diam. with hairs to 150 µm long and 2.5-4 (-8) µm diam. at the base.

Name of Depositor JC Cooke
Chain of Custody
ATCC <<--JC Cooke<<--C.S. Hodges
Isolation
forest soil, Georgia
References

. . Can. J. Bot. 50: 2271, 1972.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation