Farrowia longicollea (Krzemieniewska et Bodura) Hawksworth, teleomorph (ATCC® 24603)

Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Chaetomium longirostre (Farrow) Ames, teleomorph
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
Perithecium development
Morphology

After 7 days at 25°C cultures growing fairly rapidly, aerial mycelium, when present, flocculose, white to pale orange, composed of hyaline hyphae mainly 1-3.5 µm diam. Cleistothecia 70-150 µm diam. with hairs to 150 µm long and 2.5-4 (-8) µm diam. at the base.

Medium ATCC® Medium 340: Rabbit food agar
Growth Conditions
Temperature: 24.0°C
Sequenced Data
>D1/D2 region of 28S rRNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCGGCCCGAGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCACCGACCGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATGGTCGGACGCCTAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCCGGCTGATCATCTGGTGTTCTCACCAGTGCACTCTGCCGGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGACAAAGGCCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCAGGGCGCAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGAC.

//

>ITS region

GGGCGCCCGCCGGAGGTACACCAAACTCTTGCATTGTATGGCCTCTCTGAGTATTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCCGAAAACCAGTGGSGGGCTCGCTGTCACCCCGAGCGTAGTAGTTT

//

Morphology

After 7 days at 25°C cultures growing fairly rapidly, aerial mycelium, when present, flocculose, white to pale orange, composed of hyaline hyphae mainly 1-3.5 µm diam. Cleistothecia 70-150 µm diam. with hairs to 150 µm long and 2.5-4 (-8) µm diam. at the base.

Name of Depositor JC Cooke
Chain of Custody
ATCC <<--JC Cooke<<--C.S. Hodges
Isolation
forest soil, Georgia
References

. . Can. J. Bot. 50: 2271, 1972.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation