Xanthophyllomyces dendrorhous Golubev (ATCC® 24228)

Strain Designations: UCD 68-653C  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Phaffia rhodozyma Miller et al., anamorph
Strain Designations UCD 68-653C
Synonym Phaffia rhodozyma Miller et al.
Application
characterization
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
characterization
Morphology After 23 days on YM agar at 20°C, colonies pale orange, smooth, butyrous. Cells ovoidal, single or with bud, pseudohyphae not observed.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 307: Cornmeal agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAGTGAAATTTATTCGGGGTTCTGTCTTTCGACGGGGCCCTACTCTTTCCTATTCCTTTAACCCACACCTGTGTCTCTCTCGGGAGACGCAAGCTCTTTTATCATTTAAACAAACACCAGTCGATTGTATGTTCGAAACACTATAAAACACAATAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACACTCTCAACCGGGTGTCCTTTCTTTGTTGAGAGGCGCCTGGCTTGGACTTGGACGGTTCTGCTGGCCCTGATTTGGTTCGGGGGTCGGCTCGTCTTAAAACGATCAGTGGGTGTGTGCGTCTGTGCTGGCGAAGCGCGGGCGGTGCCTTGACATGATAAGAAATTGTCGTCGAGTGTCGCTGTCTGTGTGAGTGTGTGGGTTTCCTCGGGAACACGCAGACTAGCTAGTACAACTAAACGACGCATGCGAACTGCTTCTAACGATACTGTGTGTGTGGTCTTTGCGGACTGCATGCGCACACTTCTGATCGGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAATCTGGCAGCCTCCGGTTGTCCGAGTTGTAAACTAGAGAAGCGTTTTCCGTGCCGGCCTGTGTACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACCACCGGTGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCGTGCTCGGACTCAGCTGGGTTCGTCCCAGTCTATTTCCGGGTGCCGCAGGTCAGCATCAGTTTCGGGCGGTGGAAAACGGGCGGGGGAAGGTGGCATCTCCGGATGTGTTATAGCCCCCGTTTGGATGCATCGCGTGGGACTGAGGAACGCAGCGCGCCTCTTTACGGGGTCGGTCTCCGGACACGAACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGAC

Morphology After 23 days on YM agar at 20°C, colonies pale orange, smooth, butyrous. Cells ovoidal, single or with bud, pseudohyphae not observed.
Name of Depositor HJ Phaff
Isolation
Betula papyrifera, Rainbow Lake, AK
Cross References

Nucleotide (GenBank) : AF139636 28S ribosomal RNA gene, and 28S-5S ribosomal RNA intergenic spacer 1, partial sequence

Nucleotide (GenBank) : AF139631 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

References

Miller MW, et al. Phaffia, a new yeast genus in the Deuteromycotina (Blastomycetes). Int. J. Syst. Bacteriol. 26: 286-291, 1976.

Fell JW, Blatt GM. Separation of strains of the yeasts Xanthophyllomyces dendrorhous and Phaffia rhodozyma based on rDNA IGS and ITS sequence analysis. J. Ind. Microbiol. Biotechnol. 23: 677-681, 1999. PubMed: 10455500

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation