Xanthophyllomyces dendrorhous Golubev, teleomorph (ATCC® 24228)

Alternate State: Phaffia rhodozyma Miller et al., anamorph  /  Strain Designations: UCD 68-653C  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Phaffia rhodozyma Miller et al., anamorph
Strain Designations UCD 68-653C
Alternate State Phaffia rhodozyma Miller et al., anamorph
Application
characterization
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
characterization
Morphology After 23 days on YM agar at 20°C, colonies pale orange, smooth, butyrous. Cells ovoidal, single or with bud, pseudohyphae not observed.
Medium Medium 200: YM agar or YM broth
Medium 307: Cornmeal agar
Medium 1245: YEPD
Growth Conditions
Temperature: 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAGTGAAATTTATTCGGGGTTCTGTCTTTCGACGGGGCCCTACTCTTTCCTATTCCTTTAACCCACACCTGTGTCTCTCTCGGGAGACGCAAGCTCTTTTATCATTTAAACAAACACCAGTCGATTGTATGTTCGAAACACTATAAAACACAATAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACACTCTCAACCGGGTGTCCTTTCTTTGTTGAGAGGCGCCTGGCTTGGACTTGGACGGTTCTGCTGGCCCTGATTTGGTTCGGGGGTCGGCTCGTCTTAAAACGATCAGTGGGTGTGTGCGTCTGTGCTGGCGAAGCGCGGGCGGTGCCTTGACATGATAAGAAATTGTCGTCGAGTGTCGCTGTCTGTGTGAGTGTGTGGGTTTCCTCGGGAACACGCAGACTAGCTAGTACAACTAAACGACGCATGCGAACTGCTTCTAACGATACTGTGTGTGTGGTCTTTGCGGACTGCATGCGCACACTTCTGATCGGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAATCTGGCAGCCTCCGGTTGTCCGAGTTGTAAACTAGAGAAGCGTTTTCCGTGCCGGCCTGTGTACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACCACCGGTGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCGTGCTCGGACTCAGCTGGGTTCGTCCCAGTCTATTTCCGGGTGCCGCAGGTCAGCATCAGTTTCGGGCGGTGGAAAACGGGCGGGGGAAGGTGGCATCTCCGGATGTGTTATAGCCCCCGTTTGGATGCATCGCGTGGGACTGAGGAACGCAGCGCGCCTCTTTACGGGGTCGGTCTCCGGACACGAACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGAC

Morphology After 23 days on YM agar at 20°C, colonies pale orange, smooth, butyrous. Cells ovoidal, single or with bud, pseudohyphae not observed.
Name of Depositor HJ Phaff
Isolation
Betula papyrifera, Rainbow Lake, AK
Cross References

Nucleotide (GenBank) : AF139636 28S ribosomal RNA gene, and 28S-5S ribosomal RNA intergenic spacer 1, partial sequence

Nucleotide (GenBank) : AF139631 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

References

Miller MW, et al. Phaffia, a new yeast genus in the Deuteromycotina (Blastomycetes). Int. J. Syst. Bacteriol. 26: 286-291, 1976.

Fell JW, Blatt GM. Separation of strains of the yeasts Xanthophyllomyces dendrorhous and Phaffia rhodozyma based on rDNA IGS and ITS sequence analysis. J. Ind. Microbiol. Biotechnol. 23: 677-681, 1999. PubMed: 10455500

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation