Ogataea polymorpha (Morais et Maia) Yamada, Maeda et Mikata, teleomorph (ATCC® 204205)

Strain Designations: LGM-128  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Pichia angusta (Teunisson et al.) Kurtzman, teleomorph
Strain Designations LGM-128
Application
This material is available under the condition that it will not be used for commercial purpose or distributed to third parties.
Biosafety Level 1
Product Format frozen
Type Strain no
Genotype met6-1 glr2-1 RefParpinello G, et al. A regulatory mutant of Hansenula polymorpha exhibiting methanol utilization metabolism and peroxisome proliferation in glucose. J. Bacteriol. 180: 2958-2967, 1998. PubMed: 9603888
Preceptrol® no
Comments
This material is available under the condition that it will not be used for commercial purpose or distributed to third parties.
Morphology

After 3 days at 25°C growth is butyrous and tannish-white in color, cells are spheroidal to elongate, (1.5-4.6)x(1.9-5.3) um, occurring singly, in pairs, or in small clusters. 

Growth Conditions
Temperature: 25.0°C
Sequenced Data
GenBank accession number: JX094782

18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTCTAAGCTGGAGCTGCTGATCGACTGAACTGTTTGCCTGCGCTGCTGAAATATTGCGTGCGCGGCGATGGTTTTTTTGGTTGCAGTTCTACTCAAGGCTTAGAAATCTCCTTACACACTTTGTTTTCTTATTAGAGACAAATTTGCTTTGGCTAGCGGTCGCTTAAGCGCGGCATGGCTGGCCAGAGGTTTTAACAAAACTCATTTTCGTCTTGCCCATGTGGGGAAGACTGAAAACTTGTATTATGATTTTGTCAGTTATAAGAAGTTGCGTTTGCAGCTTTTCTAAACTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGATTTTCGTGAATCATTGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACCCTCGGGTTTGGTGATGGGCAATACTCTCTTTTCTGAGAGTTTGCTTGAAATGAATTGGCATGAGTTTTTGATACGAACTTCAGCTGTTTATTCAATGTATTAGGTTTTATCCATCGTTGATTGACAACTGCAAGCTTCTTTCAAAAATTGGCTCTGCCTTACAAACTTTAATCATAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAG

GenBank accession number: JX094792

Large subunit ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGAAGAAAGCTATCTTGGAGGTGGCCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGATGAGGTGTCCATTTCCGTGTAAGATGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCAGACTTGGTATTTAGCTATCATCGCTCCTTGTGGGTGGTGCTCTAGCTTTTTACTGGGCCAGCATCAGTTTTGGTGGCAAGATAATGACAGTTGAATGTGGCTCCTCGGAGTGTTATAGCTTCTGTTGATGTTGCCTACCGAGACTGAGGTCTGCGGCTTTTGCCTAGGATGCTGGCGTAATGATCCAATACCGC

Morphology

After 3 days at 25°C growth is butyrous and tannish-white in color, cells are spheroidal to elongate, (1.5-4.6)x(1.9-5.3) um, occurring singly, in pairs, or in small clusters. 

Name of Depositor E Berardi
Special Collection NCRR Contract
Isolation
glucose-positive mutant derived from strain LGM-242.11, which was derived from NCYC 495
References

Parpinello G, et al. A regulatory mutant of Hansenula polymorpha exhibiting methanol utilization metabolism and peroxisome proliferation in glucose. J. Bacteriol. 180: 2958-2967, 1998. PubMed: 9603888

Parpinello G, et al. A regulatory mutant of Hansenula polymorpha exhibiting methanol utilization metabolism and peroxisome proliferation in glucose. J. Bacteriol. 180: 2958-2967, 1998. PubMed: 9603888

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation