Ogataea polymorpha (Morais et Maia) Yamada, Maeda et Mikata, teleomorph (ATCC® 14754)

Strain Designations: NRRL Y-1798 [ATCC 24609, CBS 1976, CCRC 22167, IFO 0799, JCM 3620, NCYC 495, VKM Y-1397, VKPM Y-123]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Hansenula angusta Wickerham, teleomorph
Strain Designations NRRL Y-1798 [ATCC 24609, CBS 1976, CCRC 22167, IFO 0799, JCM 3620, NCYC 495, VKM Y-1397, VKPM Y-123]
Biosafety Level 1
Product Format freeze-dried
Type Strain yes (type strain of Hansenula angusta)
Preceptrol® no
Morphology

After 3 days at 25°C an YM medium cells are spheroidal to elongate, (1.5-4.6) x (1.9-5.3) um, single in pairs, or in small clusters.  Growth is butyrous and tannish-white in color.

Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
GenBank accession number: FJ914920

18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTCTAAGCTGGAGCTGCTGATCGACTGAACTGTTTGCCTGCGCTGCTGAAATATTGCGTGCGCGGCGATGGTTTTTTTGGTTGCAGTTCTACTCAAGGCTTAGAAATCTCCTTACACACTTTGTTTTCTTATTAGAGACAAATTTGCTTTGGCTAGCGGTCGCTTAAGCGCGGCATGGCTGGCCAGAGGTTTTAACAAAACTCATTTTCGTCTTGCCCATGTGGGGAAGACTGAAAACTTGTATTATGATTTTGTCAGTTATAAGAAGTTGCGTTTGCAGCTTTTCTAAACTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGATTTTCGTGAATCATTGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACCCTCGGGTTTGGTGATGGGCAATACTCTCTTTTCTGAGAGTTTGCTTGAAATGAATTGGCATGAGTTTTTGATACGAACTTCAGCTGTTTATTCAATGTATTAGGTTTTATCCATCGTTGATTGACAACTGCAAGCTTCTTTCAAAAATTGGCTCTGCCTTACAAACTTTAATCATAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCAT

GenBank accession number: FJ914937

         Large subunit ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGAAGAAAGCTATCTTGGAGGTGGCCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGATGAGGTGTCCATTTCCGTGTAAGATGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCAGACTTGGTATTTAGCTATCATCGCTCCTTGTGGGTGGTGCTCTAGCTTTTTACTGGGCCAGCATCAGTTTTGGTGGCAAGATAATGACAGTTGAATGTGGCTCCTCGGAGTGTTATAGCTTCTGTTGATGTTGCCTACCGAGACTGAGGTCTGCGGCTTTTGCCTAGGATGCTGGCGTAATGATCCAATACCGC

Morphology

After 3 days at 25°C an YM medium cells are spheroidal to elongate, (1.5-4.6) x (1.9-5.3) um, single in pairs, or in small clusters.  Growth is butyrous and tannish-white in color.

Name of Depositor NRRL
Isolation
spoiled orange juice, Florida
Cross References

Nucleotide (GenBank) : FJ914937 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914920 ITS including 5.8S rRNA gene

References

Wickerham LJ. Taxonomy of yeasts. U.S. Dep. Agric. Tech. Bull. 1029: 1951..

Titorenko VI, et al. Identification and characterization of cytosolic Hansenula polymorpha proteins belonging to the Hsp70 protein family. Yeast 12: 849-857, 1996. PubMed: 8840502

Baerends RJ, et al. Deviant Pex3p levels affect normal peroxisome formation in Hansenula polymorpha: high steady-state levels of the protein fully abolish matrix protein import. Yeast 13: 1437-1448, 1997. PubMed: 9434349

Suh SO, Zhou JJ. Methylotrophic yeasts near Ogataea (Hansenula) polymorpha: a proposal of Ogataea angusta comb. nov. and Candida parapolymorpha sp.nov. FEMS Yeast Res. 10: 631-638, 2010. PubMed: 20491937

type strain of Hansenula angusta

type strain of Hansenula angusta

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation