Absidia coerulea Bainier, teleomorph (ATCC® 14076)

Strain Designations: D-101  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations D-101
Application
Produces chitin deacetylase
Produces chitosan
Produces plasmin fibrinase, fibrinolysin
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 14 days on Potato Dextrose Medium at 25°C, colonies are floccose, and black; reverse greyish with light buff. Cells are columellae visible; guttulata in hyphae; black hyphae; sporangiospores visible; and sporangiospores hyaline.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical Aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAAAAAKGGSGAGGGGASGATTTATSGMCCCTTCACACTTTTTTCTGTGCACTGTTCATGTTTTGATTTGAACGGAGGGAGCGCAAGCTTCTTTCCGGCCAAATTCAATGACCGCGGACCCTGGATATTTTTAGCCCCTGAATTCATGCGGCCAAATTTTTTCCCACGGTCCGTTTACCCACTCTTCTAACACTGACTGAACCACAAAACATAAAGTTTAAACAACTTTCAGCAATGGATCTCTCGGCTTTCGTATCGATGAAGAACGCAGCGAATCGCGATATGTAGTGTGATCTGCCTTTAGTGAATCATCAAATCTTTGAACGCATCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTCAGTATCATTATAACCTCTTGCCCARATGTATTTTTGGAAAAAGAGAATATGACAGTTGGCCCTGCGTCTCTGCAAAGAGTCGTCTCGGCTTGAATACCCTGTTGATTGTAACTGTTTCATCTACGGTCATCACTTGATAATTATCGTGTGTCTAACCAGAAATGAAGCGGGATCGACCGTATCAAACCCCCCTAAACTTGATCTGAAATCAGGSGGGATTACCCGCTGAACTTAAR


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTCCCCTAGTAACGGCGAGTGAACAGGGAAAAGCTCAAAGTTGGAACCTCCTGGTCCTAGATTAGGCGGATTGTAAACTAAAGCTCTTGGGTAGTACGGTTGGCCTGATAAAAAAGTTCTCTGGAAAGAGGCGACATAGAGGGTGATATCCCCGTCTTTGGTCAGAGCTCAATCATGCGTTTGCCCTTTAGCGAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGAGGTAAATCTCTCCTAAAGCTAAATATTGACGAAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGGGTCAAAAAGTACGTGAAATTGCTGAAAGGGAACCGTATGAAATCAGTCTGATGTGTTGGTAATCAATCTGGATCTCGATCCGGATGCACTTGCCGATGTATTAGCCTGCGACAGTTTGATCTGGAGGAAAAAAGATGGGAGAATGTGGCCTTGGCTTCGGTTAAGGTGTTATAGCTCCTGTCAAAATACTTTGGATTGGACTGAGGACTGCAGCGAGCCGCAAGGTAAAGGTCTCGGGCGCTTGYTCTGGTTATGTAAGAAATCTCTGCTTCGGGTGGTATCTTGMCTAATCRGGACAACACGCTTGTTTCTCTTTTTTCTCGCTTAGGTCGTAGGCATAATGATTTTATATGAC

Morphology After 14 days on Potato Dextrose Medium at 25°C, colonies are floccose, and black; reverse greyish with light buff. Cells are columellae visible; guttulata in hyphae; black hyphae; sporangiospores visible; and sporangiospores hyaline.
Name of Depositor M Stefanini
References

Rane KD, Hoover DG. An evluation of alkali and acid treatments for chitosan extraction from fungi. Process Biochem. 28: 115-118, 1993.

Rane KD, Hoover DG. Production of chitosan by fungi. Food Biotechnol. 7: 11-33, 1993.

Dunkel C, Knorr D. Enhancement of chitin deacetylase activity in Mucor rouxii and Absidia coreluea [coerulea] with chitin and its detection with a non-radioactive substrate. Food Biotechnol. 8: 67-74, 1994.

Stefanini M, Marin H. Fibrinolysis. I. Fibrinolytic activity of extracts from non-pathogenic fungi. Proc. Soc. Exp. Biol. Med. 99: 504-507, 1958. PubMed: 13601918

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation