Absidia coerulea Bainier, teleomorph (ATCC® 14076)

Strain Designations: D-101  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations D-101
Application
Produces chitin deacetylase
Produces chitosan
Produces plasmin fibrinase, fibrinolysin
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 14 days on Potato Dextrose Medium at 25°C, colonies are floccose, and black; reverse greyish with light buff. Cells are columellae visible; guttulata in hyphae; black hyphae; sporangiospores visible; and sporangiospores hyaline.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical Aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAAAAAKGGSGAGGGGASGATTTATSGMCCCTTCACACTTTTTTCTGTGCACTGTTCATGTTTTGATTTGAACGGAGGGAGCGCAAGCTTCTTTCCGGCCAAATTCAATGACCGCGGACCCTGGATATTTTTAGCCCCTGAATTCATGCGGCCAAATTTTTTCCCACGGTCCGTTTACCCACTCTTCTAACACTGACTGAACCACAAAACATAAAGTTTAAACAACTTTCAGCAATGGATCTCTCGGCTTTCGTATCGATGAAGAACGCAGCGAATCGCGATATGTAGTGTGATCTGCCTTTAGTGAATCATCAAATCTTTGAACGCATCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTCAGTATCATTATAACCTCTTGCCCARATGTATTTTTGGAAAAAGAGAATATGACAGTTGGCCCTGCGTCTCTGCAAAGAGTCGTCTCGGCTTGAATACCCTGTTGATTGTAACTGTTTCATCTACGGTCATCACTTGATAATTATCGTGTGTCTAACCAGAAATGAAGCGGGATCGACCGTATCAAACCCCCCTAAACTTGATCTGAAATCAGGSGGGATTACCCGCTGAACTTAAR


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTCCCCTAGTAACGGCGAGTGAACAGGGAAAAGCTCAAAGTTGGAACCTCCTGGTCCTAGATTAGGCGGATTGTAAACTAAAGCTCTTGGGTAGTACGGTTGGCCTGATAAAAAAGTTCTCTGGAAAGAGGCGACATAGAGGGTGATATCCCCGTCTTTGGTCAGAGCTCAATCATGCGTTTGCCCTTTAGCGAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAAATGGGAGGTAAATCTCTCCTAAAGCTAAATATTGACGAAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGGGTCAAAAAGTACGTGAAATTGCTGAAAGGGAACCGTATGAAATCAGTCTGATGTGTTGGTAATCAATCTGGATCTCGATCCGGATGCACTTGCCGATGTATTAGCCTGCGACAGTTTGATCTGGAGGAAAAAAGATGGGAGAATGTGGCCTTGGCTTCGGTTAAGGTGTTATAGCTCCTGTCAAAATACTTTGGATTGGACTGAGGACTGCAGCGAGCCGCAAGGTAAAGGTCTCGGGCGCTTGYTCTGGTTATGTAAGAAATCTCTGCTTCGGGTGGTATCTTGMCTAATCRGGACAACACGCTTGTTTCTCTTTTTTCTCGCTTAGGTCGTAGGCATAATGATTTTATATGAC

Morphology After 14 days on Potato Dextrose Medium at 25°C, colonies are floccose, and black; reverse greyish with light buff. Cells are columellae visible; guttulata in hyphae; black hyphae; sporangiospores visible; and sporangiospores hyaline.
Name of Depositor M Stefanini
References

Rane KD, Hoover DG. An evluation of alkali and acid treatments for chitosan extraction from fungi. Process Biochem. 28: 115-118, 1993.

Rane KD, Hoover DG. Production of chitosan by fungi. Food Biotechnol. 7: 11-33, 1993.

Dunkel C, Knorr D. Enhancement of chitin deacetylase activity in Mucor rouxii and Absidia coreluea [coerulea] with chitin and its detection with a non-radioactive substrate. Food Biotechnol. 8: 67-74, 1994.

Stefanini M, Marin H. Fibrinolysis. I. Fibrinolytic activity of extracts from non-pathogenic fungi. Proc. Soc. Exp. Biol. Med. 99: 504-507, 1958. PubMed: 13601918

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation