Colletotrichum graminicola (Cesati) Wilson, anamorph (ATCC® MYA-4925)

Alternate State: Glomerella graminicola Politis, teleomorph  /  Strain Designations: M1.001 [FGSC 10212, M2]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations M1.001 [FGSC 10212, M2]
Alternate State Glomerella graminicola Politis, teleomorph
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Preceptrol® no
Comments Plant pathogen
Genome sequencing strain (The Broad Institute, USA)
Morphology Colonies after 5 days on Potato dextrose agar at 25°C grey to brown with salmon patches, reverse vinaceous to purple. Conidia straight, cylindrical and obtuse at the apex.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 323: Malt agar medium
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTTGGTGAACCAGCGGAGGGATCATTACTGAGTTACCGCTCTATAACCCTTTGTGAACATACCTAACCGTTGCTTCGGCGGGTTAGGGGGTCCCCTCTCCGGGGGACGCCCTCCCGGCCGGGCCCCACTGCGGGGCTCGGCGCCCGCCGGAGGATAACCAAACTCTGATTTAACGACGTCTCTTCTGAGTGGCACAAGCAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCCGCTTGGTGTTGGGGCCCTACGGCGTACGTCGTAGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTAACGTCTCGCATCGGGATCCGGAGGGACTCTTGCCGTAAAACCCCCAACTTTTTAACTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCAGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGTGACCAGACTTGCGCCCGGTGAATCACCCAGCTCTCGCGGCTGGGGCACTTCGCCGGCACAGGCCAGCATCAGCTCGCCGTCGGGGACAAAAGCTTGGGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCCCTTGCATAATACCCTTCGGCGGGCTGAGGTACGCGTTCGCAAGGATGCTGGCGTAATGGTCATCAGCGAC

Morphology Colonies after 5 days on Potato dextrose agar at 25°C grey to brown with salmon patches, reverse vinaceous to purple. Conidia straight, cylindrical and obtuse at the apex.
Name of Depositor FGSC
Chain of Custody ATCC <-- FGSC
Isolation Infected maize, Missouri, USA.
References

O’Connell RJ, et al. Lifestyle transitions in plant pathogenic Colletotrichum fungi deciphered by genome and transcriptome analyses. Nat. Genet. 44: 1060-1065, 2012 PubMed: 22885923

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation