Fusarium verticillioides (Saccardo) Nirenberg (ATCC® MYA-4923)

Strain Designations: FGSC 8961 [M3125]  /  Product Format: frozen

Strain Designations FGSC 8961 [M3125]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (USDA-ARS and the Institute for Genomic Research (TIGR), USA).
Morphology On PDA medium at 25°C after 15 days, mycelium white to lavender, woolly to cottony, dense. Reverse tan to dark purple. Hyphae hyaline with some staining purple, guttulate. Macroconidia hyaline, elongated oval, smooth, segmented, 16.5-31.5 X 3-4.5 µm. Microconidia hyaline, oval to ellipsoidal, smooth.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGACTCGCGAGTCAAATCGCGTTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCGGGCCCGAGTTGTAATTTGTAGAGGATACTTTTGATGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAAATCTCTGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCTTGGTTAATCATCTGGGGTTCTCCCCAGTGCACTTTTCCAGTCCAGGCCAGCATCAGTTTTCGCCGGGGGATAAAGACTTCGGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCCGTTGTGTAATACCCTGGCGGGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAACGA

Morphology On PDA medium at 25°C after 15 days, mycelium white to lavender, woolly to cottony, dense. Reverse tan to dark purple. Hyphae hyaline with some staining purple, guttulate. Macroconidia hyaline, elongated oval, smooth, segmented, 16.5-31.5 X 3-4.5 µm. Microconidia hyaline, oval to ellipsoidal, smooth.
Name of Depositor K McCluskey
Chain of Custody ATCC <-- FGSC
Isolation Wild type, field isolate of maize, Visalia, CA, USA.
References

Proctor RH, et al. Fumonisin production in the maize pathogen Fusarium verticillioides: genetic basis of naturally occuring chemical variation. J. Agric. Food Chem. 54: 2424-2430, 2006.

Brown DW, et al. Comparative analysis of 87,000 expressed sequence tags from the fumonisin-producing fungus Fusarium verticillioides. Fungal Genet Biol 42: 848-861, 2005. PubMed: 16099185