Metarhizium album Petch (ATCC® MYA-4888)

Strain Designations: ARSEF 1941  /  Product Format: frozen

Strain Designations ARSEF 1941
Synonym Metarhizium anisopliae (Metschn.) Sorokin
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Insect pathogenic fungi
Genome sequencing strain (Shanghai Institutes for Biological Sciences, CAC, China)
Morphology On YM medium at 25°C after 13 days, mycelium dingy white becoming tan over time, forming ball like stroma. Conidiophores clavate, verticillate. Conidia elongated ellipsoidal to cylindrical, produced in long chains.
Medium Medium 200: YM agar or YM broth
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JQ958302:

AGGGATCATTATCGAGTTTACTACAACTCCCAAACCCCCTTGTGAACGTATACCTTTCCAGTTGCTTCGGCGGGTATAGCCCCGGGGTCAGGTTCGCAAGAGCCTGCCCGGAACCAGGCGCCTGCCGGGGGACCAAAACTCTTGTATTTCTGTACGATAAGGAATGTCTGAGTGGTTTATAGAAGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTATTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCGGCGGTTTGGTGTTGGGGGCCGGCGATGGTGTTGGGGGCGATCTCTTCGTCCCCGCGCGCGCCGCCCCCGAAATGAATTGGCGGCCTCGCCGCGGCCTCCTCTGCGTAGTAACATGTTGCCCCTTCGCAACAGGAGCCCGGCGCGGCCACTGCCGTAAAAACCACCAACTTTTTTCACAAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAG

 

D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ958300:

AAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCAGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCTCAGGCCAGCATCAGTTTGCCTCGGGGGACAAAGGCTGCGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCGCTGCACAATACCCTGGGGCGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGA

Morphology On YM medium at 25°C after 13 days, mycelium dingy white becoming tan over time, forming ball like stroma. Conidiophores clavate, verticillate. Conidia elongated ellipsoidal to cylindrical, produced in long chains.
Name of Depositor RA Humber
Special Collection ATCC
Chain of Custody
ATCC <-- RA Humber <-- MC Rombach <-- DJ Im
Isolation
Green leafhopper, Nephotettix virescens on rice, Palawan, Roxas, Philippines
Cross References

Nucleotide (GenBank) : JQ958302 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ958300 D1/D2 region of 28S rRNA gene