Schizophyllum commune Fries (ATCC® MYA-4819)

Strain Designations: H4-8  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations H4-8
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type matA alpha4- beta6, matB alpha3-beta2
Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On PDA after 10 days at 25°C, Colonies white, dense, floccose. Hyphae hyline, thick walled, guttulate, 1.5-3 µm thick.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAATCAAACAAGTTCATCTTGTTCTGATCCTGTGCACCTTATGTAGTCCTCTAAAGCCTTCACGGGCGGCGGTTGACTACGTCTACCTCACACCTTGAAGTATGTTAACGAATGTAATCATGGTCTTGACAGACCCTAAAAAGTTAATACAACTTTCGACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATACCATCAACCCTCTTTTGACTTCGGTCTCGAGAGTGGCTTGGAAGTGGAGGTCTGCTGGAGCCTAACGGAGCCAGCTCCTCTCAAATGCATTAGCGGATTTCCCTTGCGGGATCGCGTCTCCGATGTGATAATTTCTACGTCGTTGACCATCTCGGGGCTGACCTAGTCAGTTTCAATAGGAGTCTGCTTCTAACCGTCTCTTGACTGAGACTAGCGACTTGTGCGCTAACTTTTGACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

Morphology On PDA after 10 days at 25°C, Colonies white, dense, floccose. Hyphae hyline, thick walled, guttulate, 1.5-3 µm thick.
Name of Depositor TJ Fowler
Special Collection ATCC
Chain of Custody
ATCC <-- TJ Fowler <-- C Raper <-- JR Raper
Cross References

Complete Genome (GenBank) : ADMJ00000000 Schizophyllum commune H4-8, whole genome shotgun sequencing project

References

Ohm RA, et al. Genome sequence of the model mushroom Schizophyllum commune. Nature Biotechnol. 28: 957-963, 2010.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation