Schizophyllum commune Fries (ATCC® MYA-4819)

Strain Designations: H4-8  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations H4-8
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type matA alpha4- beta6, matB alpha3-beta2
Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On PDA after 10 days at 25°C, Colonies white, dense, floccose. Hyphae hyline, thick walled, guttulate, 1.5-3 µm thick.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAATCAAACAAGTTCATCTTGTTCTGATCCTGTGCACCTTATGTAGTCCTCTAAAGCCTTCACGGGCGGCGGTTGACTACGTCTACCTCACACCTTGAAGTATGTTAACGAATGTAATCATGGTCTTGACAGACCCTAAAAAGTTAATACAACTTTCGACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATACCATCAACCCTCTTTTGACTTCGGTCTCGAGAGTGGCTTGGAAGTGGAGGTCTGCTGGAGCCTAACGGAGCCAGCTCCTCTCAAATGCATTAGCGGATTTCCCTTGCGGGATCGCGTCTCCGATGTGATAATTTCTACGTCGTTGACCATCTCGGGGCTGACCTAGTCAGTTTCAATAGGAGTCTGCTTCTAACCGTCTCTTGACTGAGACTAGCGACTTGTGCGCTAACTTTTGACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

Morphology On PDA after 10 days at 25°C, Colonies white, dense, floccose. Hyphae hyline, thick walled, guttulate, 1.5-3 µm thick.
Name of Depositor TJ Fowler
Special Collection ATCC
Chain of Custody
ATCC <-- TJ Fowler <-- C Raper <-- JR Raper
Cross References

Complete Genome (GenBank) : ADMJ00000000 Schizophyllum commune H4-8, whole genome shotgun sequencing project

References

Ohm RA, et al. Genome sequence of the model mushroom Schizophyllum commune. Nature Biotechnol. 28: 957-963, 2010.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation