Candida albicans (Robin) Berkhout, anamorph (ATCC® MYA-4784)

Strain Designations: A155  /  Product Format: frozen

Strain Designations A155
Application
Opportunistic pathogen research
Sexually Transmitted Disease Research
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Clinical isolate
Genome sequencing strain (Broad Institute, USA)
Morphology After 5 days at 25°C on YM medium, colonies white to creamy white, butyrous, smooth, raised, margin begins entire (3 days) and becomes filamentous (11 days). On YEPD medium, colonies similar, with the addition of some wrinkled colonies with filamentous margins. Cells globose to subglobose, smooth, cells 3-4.5 µm x 3-4.5 µm. Pseudohyphae abundant on YM medium and observed, but not abundant on YEPD medium.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions Temperature: 30°C to 37°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCTACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA


D1D2 region of the 28S ribosomal RNA gene:

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATGCTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTT

Morphology After 5 days at 25°C on YM medium, colonies white to creamy white, butyrous, smooth, raised, margin begins entire (3 days) and becomes filamentous (11 days). On YEPD medium, colonies similar, with the addition of some wrinkled colonies with filamentous margins. Cells globose to subglobose, smooth, cells 3-4.5 µm x 3-4.5 µm. Pseudohyphae abundant on YM medium and observed, but not abundant on YEPD medium.
Name of Depositor M Noverr
Special Collection ATCC
Chain of Custody
ATCC <-- M Noverr <-- C Fichtenbaum
Isolation
HIV patient with mucosal candidiasis, in St. Louis, MO, USA
Cross References

Nucleotide (GenBank) : JN874497 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JN882318 ITS including 5.8S rRNA gene

References

Taylor BN, et al. In vivo virulence of Candida albicans isolates causing mucosal infections in people infected with the Human Immunodeficiency Virus. J. Infect. Dis. 182: 955-999, 2000.