Terfezia boudieri Chatin (ATCC® MYA-4762)

Strain Designations: S1  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations S1
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
desert truffle
genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology

On MD-336 at 25C after 26 days, colonies white,

cottony, aerial hyphae abundant, margin filamentous.

Hyphae guttulate, hyphal swellings present, clamps not

observed.

Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAAAAACTATTTTAAGTTTTTTATATCCCATTGTTTACTTACCCTGTTGCTTTCACTGGACAGATTTCACCTTGTGTGGGTCCTTTGGCTTGTGTGAAATACCACTTGCCAAAGAGTTGCCAGTGGTAAGACCTATTTATCAAAACTTGAGTTTCAATAAACACAACTGTCTGAATATTTTTTTTCTTTAATGAAATAAAACTTTCAACAACGGATCTCTAGGCTCTTGCATCGATGAAGAACGCAGTGAAATGCGATAAGTAATGTGAATTGCAGAATCTCGTGAATCATTGAATCTTTGAACGCACATTGCGCCCTATGGTATTCCATTGGGCATGCCTGTCTGAGCGTCAGCTCCCCCTCCACTCAAGAATTATTTTATATGATACTTGGATTACTTTGGAGATGTAACTGTATATTAAGTTGCCCTCCAGAAATTCATTGGCAGTATGGTTTGTACTTGGACCAGACGTAATAGTAATAAAATCGTTTGTTTGGGTATAATTGAATTGTACTTGCCTTAACCCCCACCCATTTTTATTTTGGGTGACCTCAGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAT

Morphology

On MD-336 at 25C after 26 days, colonies white,

cottony, aerial hyphae abundant, margin filamentous.

Hyphae guttulate, hyphal swellings present, clamps not

observed.

Name of Depositor Y Sitrit
Special Collection ATCC
Chain of Custody
ATCC <-- Y Sitrit
Isolation
Monosporic culture from fruiting body, Negev desert, Israel.
Cross References

Nucleotide (GenBank) : JN882304 ITS including 5.8S rRNA gene

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation