Paxillus involutus (Batsch : Fries) Fries (ATCC® MYA-4647)

Strain Designations: ATCC 200175 [87.017]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations ATCC 200175 [87.017]
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Amino acid uptake.
Cadmium uptake.
Poisonous mushroom.
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Morphology On YM agar, after 35 days at 25°C, colonies are white to creamy, velutinous, dense, radially sulcate, and exudate is brown to dark brownin color. Clamp connections present on hyphae, spores not observed.
Medium Medium 200: YM agar or YM broth
Medium 28: Emmons' modification of Sabouraud's agar
Medium 2798: MMNC Medium
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CATTATCGAAAAGCAATCCGGGGGGAGGCGACCGAGCGAAGTTTGGTAGATCGTAGGGATTGTCGCTGGCCTTTGGAAACGAAGGCATGTGCACGTTCCGAGTTCTCCTTAGTCCTCCTTTGCCTTTCCTTTGGAAAACCCTTTCTTCACACCCGTGCACCCATTGTAGGTCTCCGCGAGGGGATCTATGTCTTCACATAAACACTACGTATGTCTAGGAATGTATCTAAAAGCGTCGGACGGCTTGGCTTCGTGCCCGGTCGGCGACGGTAAAGAACCATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCATCCCTCGATTCGTTTCGAGGGTTTGGCTTGGATTTTGGGGGCTGCCGGGCGACCCTAGGGTCTTCGGCTCTCCTTGAAAGCATTAGCGATGGCGGCGCGATCTAACCCCCCC

Morphology On YM agar, after 35 days at 25°C, colonies are white to creamy, velutinous, dense, radially sulcate, and exudate is brown to dark brownin color. Clamp connections present on hyphae, spores not observed.
Name of Depositor T Johansson
Special Collection ATCC
Chain of Custody
ATCC <-- T Johansson
Isolation
Birch plantation, Bush Estate, Penicuik, Midlothian, Scotland.
Cross References

Nucleotide (GenBank) : HQ999961 ITS including 5.8S rRNA gene

References

Chalot M, et al. Factors affecting amino acid uptake by the ectomycorrhizal fungus Paxillus involutus. Mycol. Res. 99: 1131-1138, 1995.

Chalot M, et al. Kinetics, energetics and specificity of a general amino acid transporter from the ectomycorrhizal fungus Paxillus involutus. Microbiology 142: 1749-1756, 1996.

Blaudez D, et al. Cadmium uptake and subcellular compartmentation in the ectomycorrhizal fungus Paxillus involutus. Microbiology 146: 1109-1117, 2000. PubMed: 10832638

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation