Podospora anserina (Cesati) Niessl, teleomorph (ATCC® MYA-4624)

Strain Designations: FGSC 10383 [S mat+, DSM 980]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations FGSC 10383 [S mat+, DSM 980]
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type +
Comments
Genome sequencing strain (Genoscope, France).
Medium Medium 336: Potato dextrose agar (PDA)
Medium 324: Malt extract agar
Growth Conditions
Temperature: 25.0°C
Sequenced Data
>ITS of MYA-4624

GTCTCCGTTGGTGAACCAGCGGAGGGATCATTAAAGAGTTGCAAGACTCCCACAAACCATCGCGAACCGAACCCCTGAGCAGTTGCTTCGGCGGGCCGGCCCCCCACCGCGGGGCGCCGTCACAGGCCCGCCGGAGGCACCCAAACCATTGTCTTTGCAGGCCTCTCTGAGTATTACTTAAACAAGTCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCATCAAGCCCCGGGCTTGTGTTGGGGACCTGCGTCCGACGCAGGCCCTGAAAACCAGTGGCGGGCTCGCTGTCCACGCCGAGCGTAGTAACTCACCTCGCTGCGGAGTGGCGCGGGCGCCTGCCGTGAAACCCCCGACCCCCAAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA

//

Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Cross References

Nucleotide (GenBank) : GU327640 ITS including 5.8S rRNA gene

References

Espagne E, et al. The genome sequence of the model ascomycete fungus Podospora anserina. Genome Biol. 9: R77, 2009.

Silar P, et al. Characterization of the genomic organization of the region bordering the centromere of chromosome V of Podospora anserina by direct sequencing. Fungal Genet. Biol. 39:250-263, 2003.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation