Coprinopsis cinerea (Schaeff.) Redhead, Vilgalys et Moncalvo (ATCC® MYA-4618)

Strain Designations: FGSC 9003 [okayama7#130]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Coprinus cinereus (Schaeff.) Gray
Strain Designations FGSC 9003 [okayama7#130]
Biosafety Level 1
Product Format frozen
Type Strain no
Genotype ade8-1
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type A43B43
Comments
Genome sequencing strain (Broad Institute, USA).
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
>ITS of MYA-4618

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAATCTGACGTGGTTGTCGCTGGCTCCCCCGGGAGCATGTGCACGCCCGTCACCTTTATTTCTCCACCTGTGCACACACTGTAGGCCTGGATACCTCTCGTCGCAAGGCGGATGCGTGGCTTGCTGTCGCTTTCGAAAGAAGGCCGGCTTGCCATGAATTTCCAGGTCTATGATTTCTTACACACCCCAAACTGAATGTTATGGAATGTCATCTCAAGGCCTTGTGCCTATAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAACTTTGTTGTGTGCAGGCTTGGATGTGGGGGTTGCAGGTCCACTCTCGTGGTCTGCTCCTCTGAAATGTATTAGTGGGTTGTGCCCCTAATCTATTGGTGTGATAATTATCTACGCCGTGGATTGGGTTGGTTACTTGAAGACCTGCTTCTAACCGTCCCTTGGACAACTTTTGACAATTTTGACCTCAAATCAGGCAAGACTACCCGCTGAACTTAA

//

Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATYCC <-- FGSC
Cross References

Nucleotide (GenBank) : GU327634 ITS including 5.8S rRNA gene

References

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

May G, Chevanton LL, Pukkila PJ. Molecular analysis of the Coprinus cinereus mating type A factor demonstrates an unexpectedly complex structure. Genetics 128: 529-538, 1991.

Stajich JE, et al. Insights into evolution of multicellular fungi from the assembled chromosomes of the mushroom Coprinopsis cinerea (Coprinus cinereus). Proc. Natl. Acad. Sci. USA. 29;107(26): 11889-11894, 2010. PubMed : 20547848

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation