Coprinopsis cinerea (Schaeff.) Redhead, Vilgalys et Moncalvo (ATCC® MYA-4618)

Strain Designations: FGSC 9003 [okayama7#130]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Coprinus cinereus (Schaeff.) Gray
Strain Designations FGSC 9003 [okayama7#130]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Genotype ade8-1
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type A43B43
Comments
Genome sequencing strain (Broad Institute, USA).
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
>ITS of MYA-4618

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAATCTGACGTGGTTGTCGCTGGCTCCCCCGGGAGCATGTGCACGCCCGTCACCTTTATTTCTCCACCTGTGCACACACTGTAGGCCTGGATACCTCTCGTCGCAAGGCGGATGCGTGGCTTGCTGTCGCTTTCGAAAGAAGGCCGGCTTGCCATGAATTTCCAGGTCTATGATTTCTTACACACCCCAAACTGAATGTTATGGAATGTCATCTCAAGGCCTTGTGCCTATAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAACTTTGTTGTGTGCAGGCTTGGATGTGGGGGTTGCAGGTCCACTCTCGTGGTCTGCTCCTCTGAAATGTATTAGTGGGTTGTGCCCCTAATCTATTGGTGTGATAATTATCTACGCCGTGGATTGGGTTGGTTACTTGAAGACCTGCTTCTAACCGTCCCTTGGACAACTTTTGACAATTTTGACCTCAAATCAGGCAAGACTACCCGCTGAACTTAA

//

Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATYCC <-- FGSC
Cross References

Nucleotide (GenBank) : GU327634 ITS including 5.8S rRNA gene

References

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

May G, Chevanton LL, Pukkila PJ. Molecular analysis of the Coprinus cinereus mating type A factor demonstrates an unexpectedly complex structure. Genetics 128: 529-538, 1991.

Stajich JE, et al. Insights into evolution of multicellular fungi from the assembled chromosomes of the mushroom Coprinopsis cinerea (Coprinus cinereus). Proc. Natl. Acad. Sci. USA. 29;107(26): 11889-11894, 2010. PubMed : 20547848

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation