Trichophyton tonsurans Malmsten (ATCC® MYA-4606)

Strain Designations: CBS 127.97  /  Product Format: frozen

Deposited As Trichophyton tonsurans Malmsten
Strain Designations CBS 127.97
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
The strain is also known as Trichophyton equinum var. equinum.
Genome sequencing strain (as Trichophyton equinum by Broad Institute, USA).
Medium ATCC® Medium 323: Malt agar medium
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
ITS DNA sequence of MYA-4606

GGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCAGGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATAT

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- E Tunnela
Isolation
Man in onychomycosis and tinea manuum, Finland.
Cross References

Complete Genome (GenBank) : ABWI00000000 Trichophyton equinum CBS 127.97, whole genome shotgun sequencing project

References

Achterman RR, et al. Sequenced dermatophyte strains: Growth rate, conidiation, drug susceptibilities, and virulence in an invertebrate model. Fungal Genet. Biol. 48(3): 335–341, 2011. PubMed: 21145410