Trichophyton tonsurans Malmsten (ATCC® MYA-4606)

Strain Designations: CBS 127.97  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Trichophyton tonsurans Malmsten
Strain Designations CBS 127.97
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
The strain is also known as Trichophyton equinum var. equinum.
Genome sequencing strain (as Trichophyton equinum by Broad Institute, USA).
Medium ATCC® Medium 323: Malt agar medium
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
ITS DNA sequence of MYA-4606

GGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCAGGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATAT

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- E Tunnela
Isolation
Man in onychomycosis and tinea manuum, Finland.
Cross References

Complete Genome (GenBank) : ABWI00000000 Trichophyton equinum CBS 127.97, whole genome shotgun sequencing project

References

Achterman RR, et al. Sequenced dermatophyte strains: Growth rate, conidiation, drug susceptibilities, and virulence in an invertebrate model. Fungal Genet. Biol. 48(3): 335–341, 2011. PubMed: 21145410

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation