Microsporum gypseum (Bodin) Guiart et Grigorakis, anamorph (ATCC® MYA-4604)

Alternate State: Arthroderma gypseum (Nannizzi) Weitzman et al., teleomorph, Arthroderma incurvatum (Stockdale) Weitzman et al., teleomorph  /  Strain Designations: CBS 118893  /  Product Format: frozen

Strain Designations CBS 118893
Alternate State Arthroderma gypseum (Nannizzi) Weitzman et al., teleomorph, Arthroderma incurvatum (Stockdale) Weitzman et al., teleomorph
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institiute, USA).
Dermatophyte fungus causes skin infections of the head and torso of humans.
Sequenced Data
ITS DNA sequence of MYA-4604

GTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGTAGACGGCCCGTCCCCGGATGCGTCCGGGGGCGGTGTCGCCGGCCACACGCCCATTCTTGTCTATTTACCCAGTTGCCTCGGCGGGCCGCGCACTCGTGCCGCGCCTCGAGGAGCCGTCCGGGGACAATCAACTCCCTGGATCGCGCCCGCCGGAGGAGTGATTAAAATCCATGAATACTGTTCCGTCTGAGCGTTAGCAAGTAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCCGCCCTCCCTACTCCAGGGGAGGGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTCCTGGGCGAATGGGCAACAAACCAACGCCTCTAGGACCGGCCGGTTTTCTGGCCTAGTTTTAGTTAGGGATGAACTTCCCTACAATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- Y Graser
Isolation
Skin of patient, Uganda.
Cross References

Nucleotide (GenBank) : GU291264 ITS including 5.8S rRNA gene