Dekkera bruxellensis van der Walt (ATCC® MYA-4596)

Strain Designations: Y879 [CBS 2499]  /  Product Format: frozen

Strain Designations Y879 [CBS 2499]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Wine spoilage yeast.
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Sequenced mitochondrial genome.
Sequenced Data
D1D2 DNA sequence of MYA-4596

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAATGGCGAATGAAGCGGCAAGAGCCCAAATTTGAAATCGGGCAACCGAGTTGTAATTTGGAGACGGGACACTAGAGAGGAGGAAGGCGATTAAGTGCCTTGGAACAGGCTGCCGTAGAGGGTGAGAGCCCCGTGAATCGCTGGAGACCGATCAATTAGTGCCCGCCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATTAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGGAAAGAGAGTGAAATAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTGTTTAGCAGCGGCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGGCCAGCATCGGTTCTGGGAGCCATATACGGGGTTCGTGAATGTGGCCCTTCGATTCTGTCGGAGGGTGTTATAGCGCGGACATCTTGTGGCTAGCCGGGACCGGGGACTGCGGTGACTTGTCACCAAGGATGCTGGCAGAACGAGCAAATACCACCCGTCTTG

Name of Depositor J Piskur
Special Collection ATCC
Chain of Custody
ATCC <-- J Piskur <-- CBS
Isolation
Wine, Medoc, France.
Cross References

Nucleotide (GenBank) : GU291284 D1/D2 region of 28S rRNA gene

References

Woolfit M, et al. Genome survey sequencing of the wine spoilage yeast Dekkera (Brettanomyces) bruxellensis. Eukaryot. Cell 6:721-733, 2007.