Dekkera bruxellensis van der Walt, teleomorph (ATCC® MYA-4596)

Alternate State: Brettanomyces bruxellensis Kufferath et van Laer, anamorph  /  Strain Designations: Y879 [CBS 2499]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations Y879 [CBS 2499]
Alternate State Brettanomyces bruxellensis Kufferath et van Laer, anamorph
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Wine spoilage yeast.
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Sequenced mitochondrial genome.
Sequenced Data
D1D2 DNA sequence of MYA-4596

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAATGGCGAATGAAGCGGCAAGAGCCCAAATTTGAAATCGGGCAACCGAGTTGTAATTTGGAGACGGGACACTAGAGAGGAGGAAGGCGATTAAGTGCCTTGGAACAGGCTGCCGTAGAGGGTGAGAGCCCCGTGAATCGCTGGAGACCGATCAATTAGTGCCCGCCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATTAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGGAAAGAGAGTGAAATAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTGTTTAGCAGCGGCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGGCCAGCATCGGTTCTGGGAGCCATATACGGGGTTCGTGAATGTGGCCCTTCGATTCTGTCGGAGGGTGTTATAGCGCGGACATCTTGTGGCTAGCCGGGACCGGGGACTGCGGTGACTTGTCACCAAGGATGCTGGCAGAACGAGCAAATACCACCCGTCTTG

Name of Depositor J Piskur
Special Collection ATCC
Chain of Custody
ATCC <-- J Piskur <-- CBS
Isolation
Wine, Medoc, France.
Cross References

Nucleotide (GenBank) : GU291284 D1/D2 region of 28S rRNA gene

References

Woolfit M, et al. Genome survey sequencing of the wine spoilage yeast Dekkera (Brettanomyces) bruxellensis. Eukaryot. Cell 6:721-733, 2007.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation