Candida jiufengensis Bai et Ji (ATCC® MYA-4593)

Strain Designations: HJG-2.1.3 [AS 2.3688, CBS 10846]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations HJG-2.1.3 [AS 2.3688, CBS 10846]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments
Insect associated yeast.
mitochondrial genome sequenced strain
Sequenced Data
ITS DNA sequence of MYA-4593 lot 58704089

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAATTTAAGTGCTTAATTGCATTTTTACACATGTGTTTTTCTTTATTTAAAACTTACTTTGGTAGTGGTATTAACTTATTCGCTGCCAGAGATTAAACTTAAAACAAATTTTTATTTTAATTGTCAAATAAGATTATATAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCATACCTTCGGGTTTGGTGTTGAGCAATACGTAGGGTTTGCTTGAAAGAAAGTAGGAGTATAACTAATGGATAGGTTTTTCCACTCATTGGACAACTCCAAAATTTTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC

Name of Depositor FY Bai
Special Collection ATCC
Chain of Custody
ATCC <-- FY Bai <-- ZH Ji
Isolation
Gut of Oxycetonia jucunda, Jiufeng Mountain, Beijing, China.
Cross References

Nucleotide (GenBank) : GU291261 ITS including 5.8S rRNA gene

References

Ji ZH, Jia JH, Bai FY. Four novel Candida species in the Candida albicans/ Lodderomyces elongisporus clade isolated from the gut of flower beetles. Antonie van Leeuwenhoek 95: 23-32, 2009.

Valach M, et al. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria. Nucleic Acids Res. 39: 4202-4219, 2011.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation