Candida blackwellae Bai et Ji (ATCC® MYA-4592)

Strain Designations: MPCH-1.2.2 [AS 2.3639, CBS 10843]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations MPCH-1.2.2 [AS 2.3639, CBS 10843]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments
Insect associated yeast.
mitochondrial genome sequenced strain
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
ITS DNA sequence of MYA-4592 lot 58704088

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTATTGAATTTACCACATTTGTTTTCTAAGCAACTTTTCTTCGCGGGGGCGCCATTTATTTGTGTGCGCCCGCGGAGGCCCCAAAAACACAACTTACAATTTTTACATCAAAACGATACCAAATATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCATTTCTCCTTCAAACCCCCGGGTTTGGTGCTGAGTAATACGGCGTGCTGTTTGCTTGAATGGTATTGCGGAACGCCAATGGATAGGTCTAACCAAATCATTGCGCGGCCGCTCCCCAACCAACAAATACGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC

Name of Depositor FY Bai
Special Collection ATCC
Chain of Custody
ATCC <-- FY Bai <-- ZH Ji
Isolation
Gut of Trichius succinctus, Baiwangshan Mountain, Beijing, China.
Cross References

Nucleotide (GenBank) : GU291260 ITS including 5.8S rRNA gene

References

Ji ZH, Jia JH, Bai FY. Four novel Candida species in the Candida albicans/ Lodderomyces elongisporus clade isolated from the gut of flower beetles. Antonie van Leeuwenhoek 95: 23-32, 2009.

Valach M, et al. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria. Nucleic Acids Res. 39: 4202-4219, 2011.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation