Phytophthora infestans (Montagne) de Bary (ATCC® MYA-4127)

Strain Designations: T30-4  /  Product Format: frozen

Strain Designations T30-4
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Plant pathogen.
Genome sequencing strain (Broad Institute, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCACACCTAAAAACTTTCCACGTGAACCGTTTCAACCCAATAGTTGGGGGTCTTACTTGGCGGCGGCTGCTGGCTTTATTGCTGGCGGCTACTGCTGGGCGAGCCCTATCAAAAGGCGAGCGTTTGGACTTCGGTCTGAGCTAGTAGCTTTTTTATTTTAAACCCTTTACTTAATACTGATTATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCGGTTGGTTTTCGGACCGACTGCGAGTCCTTTTAAATGTACTAAACTGTACTTCTCTTTGCTCCAAAAGTGGTGGCATTGCTGGTTGTGGACGCTGCTATTGTAGCGAGTTGGCGACCGGTTTGTCTGCTGCGGCGTTAATGGAGAAATGCTCGATTCGTGGTATGGTTGGCTTCGGCTGAACAATGCGCTTATTGGGTGATTTTCCTGCTGTGGCGTGATGGACTGGTGAACCATGGCTCTTTAGCTTGGCATTTGAATCGGCTTTGCTGTTGCGAAGTAGAGTGGCGGCTTCGGCTGCCGAGGGTCGATCCATTTGGGAAATGTTGTGTACTTCGGTATGCATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGA


D1D2 region of the 28S ribosomal RNA gene

CATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAACTTAAGCATATTAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTTTGGCTGCGCTCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGGGCCTGTGTCTCTGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTAACTTGTTG

Name of Depositor F Govers
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- F Govers
Isolation
Potato (Solanun tuberosum), Netherlands.
Geographical Isolation Generated in Laboratory of Phytopathology
Cross References

Complete Genome (GenBank) : AATU00000000 Phytophthora infestans T30-4, whole genome shotgun sequencing project

References

Haas BJ, et al. Genome sequence and analysis of the Irish potato famine pathogen Phytophthora infestans. Nature 461:393-398, 2009. PubMed: 19741609